Syntenin 2 (SDCBP2) (NM_001199784) Human Untagged Clone

CAT#: SC329564

SDCBP2 (untagged) - Homo sapiens syndecan binding protein (syntenin) 2 (SDCBP2), transcript variant 3



  "NM_001199784" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Goat Anti-SDCBP2 / Syntenin 2 Antibody
    • 100 ug

CNY 5,371.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SITAC; SITAC18; ST-2; ST2
Vector pCMV6-Entry
Sequence Data
>SC329564 representing NM_001199784.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCATCCCTGTACCCATCTCTAGAGGACCTAAAAGTGGACCAAGCCATTCAGGCCCAGGTCAGAGCC
TCACCCAAGATGCCAGCCCTGCCAGTCCAGGCAACAGCCATTTCCCCACCACCAGTTTTGTACCCAAAC
TTGGCAGAACTGGAAAATTATATGGGTCTTTCCCTCTCCAGCCAAGAAGTCCAGGAGAGCCTGCTTCAG
ATTCCAGAGGGTGACAGTACAGCGGTCTCGGGCCCCGGGCCCGGCCAGATGGTGGCACCGGTAACCGGG
TACAGCCTGGGCGTGCGGCGAGCTGAGATCAAGCCCGGGGTGCGCGAGATCCACCTGTGCAAGGACGAG
CGCGGCAAGACCGGGCTGAGGCTGCGGAAGGTCGACCAGGGGCTCTTTGTGCAGTTGGTCCAGGCCAAC
ACCCCTGCATCCCTTGTGGGGCTGCGCTTTGGGGACCAGCTCCTGCAGATTGACGGGCGTGACTGTGCT
GGGTGGAGCTCGCACAAAGCCCATCAGGTGGTGAAGAAGGCATCAGGCGATAAGATTGTCGTGGTGGTT
CGGGACAGGCCGTTCCAGCGGACTGTCACCATGCACAAGGACAGCATGGGCCACGTCGGCTTCGTGATC
AAGAAGGGGAAGATTGTCTCTCTGGTCAAAGGGAGTTCTGCGGCCCGCAACGGGCTCCTCACCAACCAC
TACGTGTGTGAGGTGGACGGGCAGAATGTTATCGGGCTGAAGGACAAAAAGATCATGGAGATTCTGGCC
ACGGCTGGGAACGTTGTCACCCTGACCATCATCCCCAGTGTGATCTACGAGCACATGGTCAAAAAGTTG
CCTCCAGTCCTGCTCCACCACACCATGGACCACTCCATCCCAGATGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199784
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199784.1
RefSeq Size 1484 bp
RefSeq ORF 879 bp
Locus ID 27111
UniProt ID Q9H190
MW 31.6 kDa
Gene Summary The protein encoded by this gene contains two class II PDZ domains. PDZ domains facilitate protein-protein interactions by binding to the cytoplasmic C-terminus of transmembrane proteins, and PDZ-containing proteins mediate cell signaling and the organization of protein complexes. The encoded protein binds to phosphatidylinositol 4, 5-bisphosphate (PIP2) and plays a role in nuclear PIP2 organization and cell division. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Read-through transcription also exists between this gene and the upstream FKBP1A (FK506 binding protein 1A, 12kDa) gene, as represented in GeneID:100528031. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Both variants 1 and 3 encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...