NPL (NM_001200050) Human Untagged Clone

CAT#: SC329614

NPL (untagged) - Homo sapiens N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) (NPL), transcript variant 2



  "NM_001200050" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


NPL rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C1orf13; C112; NAL; NPL1
Vector pCMV6-Entry
Sequence Data
>SC329614 representing NM_001200050.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCAGGGCCCCCGGGATCCTGGCTTCTTGGAGAAGAGCCCCCTCCCTTTCTGTGCAGAAGGGCAGC
CAAACTGCTAGACACACCTGCCACCCAGAGGTTCCGCTGGGAAACTGCTTCTTACCTGTCTACAAGGCC
AGTCCCCTCACAGTTACCCGTCTTTGGGCTGAAAGGCTGGATCAGGTGATAATTCACGTAGGAGCACTG
AGCTTGAAGGAGTCACAGGAACTGGCCCAACATGCAGCAGAAATAGGAGCTGATGGCATCGCTGTCATT
GCACCGTTCTTCCTCAAGCCATGGACCAAAGATATCCTGATTAATTTCCTAAAGGAAGTGGCTGCTGCC
GCCCCTGCCCTGCCATTTTATTACTATCACATTCCTGCCTTGACAGGGGTAAAGATTCGTGCTGAGGAG
TTGTTGGATGGGATTCTGGATAAGATCCCCACCTTCCAAGGGCTGAAATTCAGTGATACAGATCTCTTA
GACTTCGGGCAATGTGTTGATCAGAATCGCCAGCAACAGTTTGCTTTCCTTTTTGGGGTGGATGAGCAA
CTGTTGAGTGCTCTGGTGATGGGAGCAACTGGAGCAGTGGGCAGTACCTATAACTACCTGGGAAAAAAG
ACAAACCAGATGTTGGAGGCTTTTGAACAAAAGGACTTCTCTTTAGCCCTGAACTATCAGTTTTGTATC
CAGAGATTTATCAACTTTGTTGTCAAACTAGGTTTTGGAGTGTCACAGACCAAAGCCATCATGACTCTG
GTCTCTGGGATTCCAATGGGCCCACCCCGGCTTCCACTGCAGAAAGCCTCCAGGGAGTTTACTGATAGT
GCTGAAGCTAAACTGAAGAGCCTGGATTTCCTTTCTTTCACTGATTTAAAGGATGGAAACTTGGAAGCT
GGTAGCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001200050
Insert Size 906 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001200050.1
RefSeq Size 3027 bp
RefSeq ORF 906 bp
Locus ID 80896
UniProt ID Q9BXD5
Protein Pathways Amino sugar and nucleotide sugar metabolism
MW 33.1 kDa
Gene Summary This gene encodes a member of the N-acetylneuraminate lyase sub-family of (beta/alpha)(8)-barrel enzymes. N-acetylneuraminate lyases regulate cellular concentrations of N-acetyl-neuraminic acid (sialic acid) by mediating the reversible conversion of sialic acid into N-acetylmannosamine and pyruvate. A pseudogene of this gene is located on the short arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (2) differs in the 5' UTR, uses an alternate splice site in the coding region and initiates translation at a downstream start site, compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...