AKAP associated Sperm Protein (ROPN1L) (NM_001201466) Human Untagged Clone

CAT#: SC329623

ROPN1L (untagged) - Homo sapiens rhophilin associated tail protein 1-like (ROPN1L), transcript variant 2



  "NM_001201466" in other vectors (2)

CNY 3,840.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-ROPN1L Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ASP; RSPH11
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001201466, the custom clone sequence may differ by one or more nucleotides


ATGCCGCTTCCCGACACCATGTTCTGCGCTCAGCAGATCCACATTCCCCCGGAGCTGCCGGACATCCTGA
AGCAATTCACCAAGGCTGCCATCCGCACCCAGCCGGCCGACGTGCTGCGGTGGTCCGCGGGCTATTTTTC
AGCTCTGTCGAGAGGAGATCCACTTCCTGTAAAGGACAGAATGGAAATGCCCACGGCAACCCAGAAAACA
GACACAGGCCTGACTCAAGGACTCCTGAAAGTTTTGCACAAGCAGTGTCACCACAAGCGGTATGTGGAAT
TAACAGATCTTGAGCAGAAGTGGAAGAACTTGTGCCTGCCGAAGGAAAAATTCAAAGCGCTCTTACAACT
GGATCCTTGTGAAAACAAAATCAAGTGGATAAACTTTTTAGCGCTTGGATGCAGCATGCTTGGTGGGTCC
TTGAACACTGCGCTGAAGCACCTGTGCGAGATCCTCACGGACGATCCGGAGGGCGGGCCCGCTCGCATCC
CCTTCAAGACGTTTTCCTACGTTTACCGCTACTTGGCCAGATTAGACTCAGATGTGTCTCCCTTGGAGAC
GGAATCCTACCTTGCCTCTCTAAAGGAAAATATAGACGCCAGGAAGAACGGCATGATAGGTCTTTCAGAT
TTCTTCTTTCCAAAGAGGAAACTTTTAGAAAGCATTGAAAACTCTGAAGATGTAGGCCATTAA


Restriction Sites SgfI-MluI     
ACCN NM_001201466
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001201466.1, NP_001188395.1
RefSeq Size 974 bp
RefSeq ORF 693 bp
Locus ID 83853
UniProt ID Q96C74
Gene Summary This gene encodes a member of the ropporin family. The encoded protein is present in sperm and interacts with A-kinase anchoring protein, AKAP3, through the amphipathic helix region of AKAP3. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (2) lacks a segment in the 5' UTR and encodes the same protein, as compared to variant 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它AKAP associated Sperm Protein产品

Customer Reviews 
Loading...