ANKS1B (NM_001204081) Human Untagged Clone

CAT#: SC329701

ANKS1B (untagged) - Homo sapiens ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), transcript variant 12



  "NM_001204081" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ANKS1B Antibody
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AIDA; AIDA-1; ANKS2; cajalin-2; EB-1; EB1
Vector pCMV6-Entry
Sequence Data
>SC329701 representing NM_001204081.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCAGGGCGATGCAAGGAGGAGAAGAAATGAAAACTACTTTGATGATATTCCCCGATCAAAACTGGAG
AGGCAGATGGCTCAGACAGGAGACTGGGGAGAACCTTCCATTACCTTGCGACCTCCGAATGAAGCCACA
GCCTCTACCCCGGTACAGTACTGGCAGCATCACCCAGAAAAGCTTATCTTCCAGTCGTGTGATTACAAA
GCTTTTTATTTAGGTTCTATGCTGATAAAAGAGCTTAGGGGGACAGAATCAACCCAAGATGCTTGTGCA
AAAATGCGGGCTAACTGTCAGAAGTCTACAGAGCAAATGAAGAAGGTCCCTACTATTATTCTTTCTGTC
TCATATAAAGGAGTCAAATTTATTGATGCAACAAATAAGAACATAATTGCTGAGCATGAAATTCGTAAT
ATCTCCTGTGCTGCCCAGGACCCAGAAGACCTCTCAACATTTGCCTATATCACAAAAGATTTGAAGTCT
AATCACCACTACTGTCATGTGTTTACTGCCTTTGATGTGAATTTAGCCTATGAAATCATCCTAACCCTG
GGACAGGCATTCGAAGTCGCTTACCAGCTAGCACTACAAGCAAGAAAAGGGGGACACTCCTCCACACTT
CCAGAAAGCTTTGAAAACAAACCCTCCAAACCCATCCCCAAGCCCCGCGTTAGCATTCGCAAGTCCGTG
GATCTTCTTCATGCCAGCCATACCGGGCAGGAACCATCAGAGAGACACACTGAGGAGGCACTCAGAAAA
TTTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001204081
Insert Size 765 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204081.1
RefSeq Size 2043 bp
RefSeq ORF 765 bp
Locus ID 56899
UniProt ID Q7Z6G8
MW 28.9 kDa
Gene Summary This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (12) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (l) has a shorter and distinct N-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...