ELOC (NM_001204857) Human Untagged Clone
CAT#: SC329771
TCEB1 (untagged) - Homo sapiens transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) (TCEB1), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SIII; TCEB1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329771 representing NM_001204857.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAATTGATATCA TCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGCACGATAAAAGCCATGTTG AGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTCAATTTTAGAGAGATACCTTCACATGTG CTATCGAAAGTATGCATGTATTTTACGTACAAGGTTCGCTACACTAACAGCTCCACCGAGATTCCTGAA TTCCCAATTGCACCTGAAATTGCACTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204857 |
Insert Size | 339 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001204857.1 |
RefSeq Size | 1924 bp |
RefSeq ORF | 339 bp |
Locus ID | 6921 |
UniProt ID | Q15369 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Pathways in cancer, Renal cell carcinoma, Ubiquitin mediated proteolysis |
MW | 12.5 kDa |
Gene Summary | This gene encodes the protein elongin C, which is a subunit of the transcription factor B (SIII) complex. The SIII complex is composed of elongins A/A2, B and C. It activates elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites within transcription units. Elongin A functions as the transcriptionally active component of the SIII complex, whereas elongins B and C are regulatory subunits. Elongin A2 is specifically expressed in the testis, and capable of forming a stable complex with elongins B and C. The von Hippel-Lindau tumor suppressor protein binds to elongins B and C, and thereby inhibits transcription elongation. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been identified. [provided by RefSeq, Mar 2011] Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR compared to variant 1. Variants 1-7 encode the same protein (isoform a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231669 | TCEB1 (Myc-DDK tagged) - Homo sapiens transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) (TCEB1), transcript variant 2 |
CNY 1,200.00 |
|
RG231669 | TCEB1 (tGFP-tagged) - Homo sapiens transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) (TCEB1), transcript variant 2 |
CNY 4,370.00 |