Transcription termination factor 1 (TTF1) (NM_001205296) Human Untagged Clone

CAT#: SC329802

TTF1 (untagged) - Homo sapiens transcription termination factor, RNA polymerase I (TTF1), transcript variant 2



  "NM_001205296" in other vectors (2)

CNY 3,710.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-TTF1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms TTF-1; TTF-I
Vector pCMV6-Entry
Sequence Data
>SC329802 representing NM_001205296.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTACCGGGACGACTTGGAACGGTTTAAGGAATTTAAAGCACAAGGTGTCGCTATTAAATTTGGCAAG
TTTTCTGTAAAGGAAAATAAGCAGTTAGAGAAAAATGTGGAAGACTTTCTAGCCCTGACAGGCATTGAG
AGTGCAGACAAGCTGCTGTACACGGACAGATATCCTGAGGAAAAATCTGTGATCACCAACTTAAAAAGG
AGATACTCGTTTAGATTACACATTGGTAGGAACATTGCCCGGCCCTGGAAACTTATATACTATCGAGCA
AAGAAGATGTTCGATGTCAACAATTACAAAGGCAGGTATAGCGAAGGAGATACTGAGAAGTTAAAGATG
TACCATTCTCTCCTTGGGAATGACTGGAAGACGATTGGTGAGATGGTGGCCCGAAGTAGCCTCTCCGTG
GCCCTCAAGTTCTCACAGATCAGCAGTCAAAGAAATCGTGGTGCTTGGAGTAAGTCTGAAACCCGGAAA
CTAATCAAGGCTGTCGAAGAAGTGATTCTGAAGAAGATGTCTCCCCAGGAGTTAAAAGAGGTGGATTCC
AAACTCCAAGAAAATCCTGAAAGTTGCCTATCAATTGTTCGGGAAAAACTCTACAAGGGCATATCTTGG
GTAGAAGTAGAAGCTAAAGTGCAAACCAGAAATTGGATGCAGTGTAAAAGTAAGTGGACAGAAATTCTA
ACCAAGAGGATGACTAATGGTCGGCGTATCTACTATGGCATGAATGCCCTGCGGGCCAAGGTCAGCCTT
ATTGAAAGGTTGTATGAAATAAATGTGGAAGATACTAATGAAATAGACTGGGAAGATCTTGCTAGTGCC
ATAGGTGATGTTCCTCCATCTTACGTTCAAACTAAATTTTCTAGGCTGAAAGCTGTCTATGTTCCATTT
TGGCAGAAAAAGACTTTTCCAGAGATCATCGACTACCTTTATGAGACGACTCTACCTTTGCTGAAGGAA
AAGTTAGAAAAAATGATGGAGAAAAAAGGCACTAAAATCCAGACTCCTGCAGCACCCAAGCAAGTTTTC
CCATTTCGAGACATCTTTTATTATGAAGACGATAGTGAAGGAGAGGACATAGAAAAAGAAAGCGAAGGC
CAGGCGCCATGCATGGCTCACGCCTGTAATTCCAGTACTTTGGGAGGCCAAGGCCGGTGGATCATCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001205296
Insert Size 1173 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001205296.1
RefSeq Size 1780 bp
RefSeq ORF 1173 bp
Locus ID 7270
UniProt ID Q15361
MW 45.6 kDa
Gene Summary This gene encodes a transcription termination factor that is localized to the nucleolus and plays a critical role in ribosomal gene transcription. The encoded protein mediates the termination of RNA polymerase I transcription by binding to Sal box terminator elements downstream of pre-rRNA coding regions. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene shares the symbol/alias 'TFF1' with another gene, NK2 homeobox 1, also known as thyroid transcription factor 1, which plays a role in the regulation of thyroid-specific gene expression. [provided by RefSeq, Apr 2011]
Transcript Variant: This variant (2) lacks an exon in the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Transcription termination factor 1产品

Customer Reviews 
Loading...