ETV7 (NM_001207041) Human Untagged Clone

CAT#: SC329892

ETV7 (untagged) - Homo sapiens ets variant 7 (ETV7), transcript variant 8



  "NM_001207041" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ETV7 mouse monoclonal antibody, clone OTI2A10 (formerly 2A10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms TEL-2; TEL2; TELB
Vector pCMV6-Entry
Sequence Data
>SC329892 representing NM_001207041.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACACCCGAAGGGGCCACCTGCTGCAGCCACCAGACCCAGGGCTTACCAGCAACTTCGGCCACCTG
GATGACCCTGGCCTGGCAAGGTGGACCCCTGGCAAGGAGGAGTCCCTCAACTTATGTCACTGTGCAGAG
CTCGGCTGCAGGACCCAGGGGGTCTGTTCCTTCCCCGCGATGCCGCAGGCCCCCATTGACGGCAGGATC
GCTGACTGCCGCCTGCTGTGGGATTACGTGTATCAGCTGCTCCTTGATACCCGATATGAGCCCTACATC
AAGTGGGAAGACAAGGACGCCAAGATCTTCCGAGTTGTGGATCCAAATGGGCTCGCCAGACTCTGGGGA
AATCACAAGAACCGGGTGAACATGACCTACGAGAAGATGTCTCGTGCCCTGCGCCACTATTATAAGCTT
AATATCATTAAGAAGGAACCGGGGCAGAAACTCCTGTTCAGATTTCTAAAGACTCCGGGAAAGATGGTC
CAGGACAAGCACAGCCACCTGGAGCCGCTGGAGAGCCAGGAGCAGGACAGAATAGAGTTCAAGGACAAG
AGGCCAGAAATCTCTCCGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001207041
Insert Size 573 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001207041.1
RefSeq Size 1460 bp
RefSeq ORF 573 bp
Locus ID 51513
UniProt ID Q9Y603
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Dorso-ventral axis formation
MW 22.2 kDa
Gene Summary The protein encoded by this gene belongs to the ETS family of transcription factors, which is a large group of evolutionarily conserved transcriptional regulators that play an important role in a variety of cellular processes throughout development and differentiation, and are involved in oncogenesis as well. This protein is predominantly expressed in hematopoietic tissues. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene (PMID:11108721).[provided by RefSeq, May 2011]
Transcript Variant: This variant (8) lacks two consecutive coding exons compared to variant 1. This results in translation initiation from an in-frame downstream AUG, and an isoform (8) with a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...