Growth hormone receptor (GHR) (NM_001242462) Human Untagged Clone

CAT#: SC329960

GHR (untagged) - Homo sapiens growth hormone receptor (GHR), transcript variant 12



  "NM_001242462" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-GHR Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GHBP; GHIP
Vector pCMV6-Entry
Sequence Data
>SC329960 representing NM_001242462.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGATCTCTGGCAGCTGCTGTTGACCTTGGCACTGGCAGGATCAAGTGATGCTTTTTCTGGAAGTGAG
GCCACAGCAGCTATCCTTAGCAGAGCACCCTGGAGTCTGCAAAGTGTTAATCCAGGCCTAAAGACAAAT
TCTTCTAAGGAGCCTAAATTCACCAAGTGCCGTTCACCTGAGCGAGAGACTTTTTCATGCCACTGGACA
GATGAGGTTCATCATGGTACAAAGAACCTAGGACCCATACAGCTGTTCTATACCAGAAGGAACACTCAA
GAATGGACTCAAGAATGGAAAGAATGCCCTGATTATGTTTCTGCTGGGGAAAACAGCTGTTACTTTAAT
TCATCGTTTACCTCCATCTGGATACCTTATTGTATCAAGCTAACTAGCAATGGTGGTACAGTGGATGAA
AAGTGTTTCTCTGTTGATGAAATAGTGCAACCAGATCCACCCATTGCCCTCAACTGGACTTTACTGAAC
GTCAGTTTAACTGGGATTCATGCAGATATCCAAGTGAGATGGGAAGCACCACGCAATGCAGATATTCAG
AAAGGATGGATGGTTCTGGAGTATGAACTTCAATACAAAGAAGTAAATGAAACTAAATGGAAAATGATG
GACCCTATATTGACAACATCAGTTCCAGTGTACTCATTGAAAGTGGATAAGGAATATGAAGTGCGTGTG
AGATCCAAACAACGAAACTCTGGAAATTATGGCGAGTTCAGTGAGGTGCTCTATGTAACACTTCCTCAG
ATGAGCCAATTTACATGTGAAGAAGATTTCTACTTTCCATGGCTCTTAATTATTATCTTTGGAATATTT
GGGCTAACAGTGATGCTATTTGTATTCTTATTTTCTAAACAGCAAAGGAAGGAAAATTAG

Restriction Sites SgfI-MluI     
ACCN NM_001242462
Insert Size 888 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242462.1
RefSeq Size 4312 bp
RefSeq ORF 888 bp
Locus ID 2690
UniProt ID P10912
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Neuroactive ligand-receptor interaction
MW 34 kDa
Gene Summary This gene encodes a member of the type I cytokine receptor family, which is a transmembrane receptor for growth hormone. Binding of growth hormone to the receptor leads to receptor dimerization and the activation of an intra- and intercellular signal transduction pathway leading to growth. Mutations in this gene have been associated with Laron syndrome, also known as the growth hormone insensitivity syndrome (GHIS), a disorder characterized by short stature. In humans and rabbits, but not rodents, growth hormone binding protein (GHBP) is generated by proteolytic cleavage of the extracellular ligand-binding domain from the mature growth hormone receptor protein. Multiple alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jun 2011]
Transcript Variant: This variant (12, also known as GHR1-277) lacks a coding exon in the 3' region, compared to variant 1. The resulting isoform (5) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...