Mohawk homeobox (MKX) (NM_001242702) Human Untagged Clone

CAT#: SC330005

MKX (untagged) - Homo sapiens mohawk homeobox (MKX), transcript variant 2



  "NM_001242702" in other vectors (2)

CNY 3,420.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
MKX mouse monoclonal antibody, clone OTI6A12 (formerly 6A12)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C10orf48; IFRX; IRXL1
Vector pCMV6-Entry
Sequence Data
>SC330005 representing NM_001242702.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAACACCATCGTCTTCAACAAGCTCAGCGGTGCGGTGCTGTTTGAGGACGGAGGCGCCTCGGAGCGG
GAGCGGGGTGGCCGGCCCTACAGCGGTGTCCTGGACAGTCCTCACGCCCGCCCCGAGGTGGGCATTCCC
GACGGCCCGCCCCTCAAGGACAACCTCGGCCTGAGACACCGGAGGACCGGCGCCCGGCAGAATGGCGGG
AAGGTGAGGCACAAGCGGCAGGCCCTGCAAGACATGGCGCGACCCCTCAAGCAGTGGCTTTACAAGCAC
CGTGACAACCCGTACCCCACCAAGACCGAGAAGATACTCTTGGCCCTCGGCTCGCAGATGACGCTAGTG
CAGGTGTCAAATTGGTTTGCTAATGCAAGACGTCGGCTTAAGAATACCGTTCGACAGCCAGATTTAAGC
TGGGCTTTGAGAATAAAGTTATACAACAAGTATGTTCAAGGCAATGCTGAACGGCTTAGCGTAAGCAGT
GATGACTCATGTTCTGAAGATGGAGAAAATCCTCCAAGAACCCACATGAACGAAGGGGGCTATAATACC
CCAGTTCACCATCCTGTGATTAAAAGTGAGAATTCGGTCATCAAAGCGGGAGTGAGGCCAGAGTCACGG
GCCAGTGAGGACTACGTGGCACCCCCCAAATACAAGAGCAGCTTGTTGAACCGTTACCTTAATGACTCT
TTGAGACATGTCATGGCCACGAACACTACCATGATGGGAAAAACAAGGCAAAGAAACCACTCGGGATCT
TTTAGCTCCAATGAATTTGAGGAAGAATTAGTGTCTCCATCGTCATCAGAAACTGAAGGCAACTTTGTC
TATCGCACAGACACTCTGGAAAACGGATCCAATAAGGGTGAAAGCGCAGCTAACAGAAAAGGACCAAGC
AAGGATGACACGTATTGGAAGGAGATCAACGCAGCTATGGCCTTAACAAATCTTGCACAGGGAAAGGAC
AAACTGCAGGGAACTACCAGCTGCATCATCCAGAAGTCGTCCCATATAGCAGAAGTAAAGACTGTCAAA
GTGCCGCTGGTGCAGCAGTTTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001242702
Insert Size 1059 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242702.1
RefSeq Size 3655 bp
RefSeq ORF 1059 bp
Locus ID 283078
UniProt ID Q8IYA7
Protein Families Transcription Factors
MW 39.3 kDa
Gene Summary The protein encoded by this gene is an IRX family-related homeobox protein that may play a role in cell adhesion. Studies in mice suggest that this protein may be a regulator of tendon development. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jun 2011]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...