ZA20D3 (ZFAND6) (NM_001242915) Human Untagged Clone

CAT#: SC330063

ZFAND6 (untagged) - Homo sapiens zinc finger, AN1-type domain 6 (ZFAND6), transcript variant 6



  "NM_001242915" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ZFAND6 Antibody
    • 100 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AWP1; ZA20D3; ZFAND5B
Vector pCMV6-Entry
Sequence Data
>SC330063 representing NM_001242915.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTCAAGAAACTAATCACAGCCAAGTGCCTATGCTTTGTTCCACTGGCTGTGGATTTTATGGAAAC
CCTCGTACAAATGGCATGTGTTCAGTATGCTATAAAGAACATCTTCAAAGACAGAATAGTAGTAATGGT
AGAATAAGCCCACCTGCAACCTCTGTCAGTAGTCTGTCTGAATCTTTACCAGTTCAATGCACAGATGGC
AGTGTGCCAGAAGCCCAGTCAGCATTAGACTCTACATCTTCATCTATGCAGCCCAGCCCTGTATCAAAT
CAGTCACTTTTATCAGAATCTGTAGCATCTTCTCAATTGGACAGTACATCTGTGGACAAAGCAGTACCT
GAAACAGAAGATGTGCAGGCTTCAGTATCAGACACAGCACAGCAGCCATCTGAAGAGCAAAGCAAGTCT
CTTGAAAAACCGAAACAAAAAAAGAATCGCTGTTTCATGTGCAGGAAGAAAGTGGGACTTACTGGGTTT
GAATGCCGGTGTGGAAATGTTTACTGTGGTGTACACCGTTACTCAGATGTACACAATTGCTCTTACAAT
TACAAAGCCGATGCTGCTGAGAAAATCAGAAAAGAAAATCCAGTAGTTGTTGGTGAAAAGATCCAAAAG
ATTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242915
Insert Size 627 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242915.1
RefSeq Size 1509 bp
RefSeq ORF 627 bp
Locus ID 54469
UniProt ID Q6FIF0
MW 22.6 kDa
Gene Summary Involved in regulation of TNF-alpha induced NF-kappa-B activation and apoptosis. Involved in modulation of 'Lys-48'-linked polyubiquitination status of TRAF2 and decreases association of TRAF2 with RIPK1. Required for PTS1 target sequence-dependent protein import into peroxisomes and PEX5 stability; may cooperate with PEX6. In vitro involved in PEX5 export from the cytosol to peroxisomes (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) differs in the 5' UTR compared to variant 1. Variants 1-7 all encode isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...