ELF5 (NM_001243081) Human Untagged Clone

CAT#: SC330079

ELF5 (untagged) - Homo sapiens E74-like factor 5 (ets domain transcription factor) (ELF5), transcript variant 4



  "NM_001243081" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
ELF5 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ESE2
Vector pCMV6-Entry
Sequence Data
>SC330079 representing NM_001243081.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCATCTCTGCCTCACTCCCACAGGGTAATGTTGGACTCGGTGACACACAGCACCTTCCTGCCTAAT
GCATCCTTCTGCGATCCCCTGATGTCGTGGACTGATCTGTTCAGCAATGAAGAGTACTACCCTGCCTTT
GAGCATCAGACAGGTTACTCCTTTTTTAATGACGCTGAAGAAAGCAAGGCCACCATCAAAGACTATGCT
GATTCCAACTGCTTGAAAACAAGTGGCATCAAAAGTCAAGACTGTCACAGTCATAGTAGAACAAGCCTC
CAAAGTTCTCATCTATGGGAATTTGTACGAGACCTGCTTCTATCTCCTGAAGAAAACTGTGGCATTCTG
GAATGGGAAGATAGGGAACAAGGAATTTTTCGGGTGGTTAAATCGGAAGCCCTGGCAAAGATGTGGGGA
CAAAGGAAGAAAAATGACAGAATGACATATGAAAAGTTGAGCAGAGCCCTGAGATACTACTATAAAACA
GGAATTTTGGAGCGGGTTGACCGAAGGTTAGTGTACAAATTTGGAAAAAATGCACACGGGTGGCAGGAA
GACAAGCTATGA

Restriction Sites SgfI-MluI     
ACCN NM_001243081
Insert Size 564 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243081.1
RefSeq Size 2222 bp
RefSeq ORF 564 bp
Locus ID 2001
UniProt ID Q9UKW6
Protein Families Transcription Factors
MW 22 kDa
Gene Summary The protein encoded by this gene is a member of an epithelium-specific subclass of the Ets transcritpion factor family. In addition to its role in regulating the later stages of terminal differentiation of keratinocytes, it appears to regulate a number of epithelium-specific genes found in tissues containing glandular epithelium such as salivary gland and prostate. It has very low affinity to DNA due to its negative regulatory domain at the amino terminus. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
Transcript Variant: This variant (4) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (4) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...