HSF2 (NM_001243094) Human Untagged Clone

CAT#: SC330082

HSF2 (untagged) - Homo sapiens heat shock transcription factor 2 (HSF2), transcript variant 3



  "NM_001243094" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
HSF2 mouse monoclonal antibody, clone OTI3E1 (formerly 3E1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HSF 2; HSTF 2
Vector pCMV6-Entry
Sequence Data
>SC330082 representing NM_001243094.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGCAGAGTTCGAACGTGCCGGCTTTCCTCAGCAAGCTGTGGACGCTTGTGGAGGAAACCCACACT
AACGAGTTCATCACCTGGAGCCAGAATGGCCAAAGTTTTCTGGTCTTGGATGAGCAACGATTTGCAAAA
GAAATTCTTCCCAAATATTTCAAGCACAATAATATGGCAAGCTTTGTGAGGCAACTGAATATGTATGGT
TTCCGTAAAGTAGTACATATCGACTCTGGAATTGTAAAGCAAGAAAGAGATGGTCCTGTAGAATTTCAG
CATCCTTACTTCAAACAAGGACAGGATGACTTGTTGGAGAACATTAAAAGGAAGGTTTCATCTTCAAAA
CCAGAAGAAAATAAAATTCGTCAGGAAGATTTAACAAAAATTATAAGTAGTGCTCAGAAGGTTCAGATA
AAACAGGAAACTATTGAGTCCAGGCTTTCTGAATTAAAAAGTGAGAATGAGTCCCTTTGGAAGGAGGTG
TCAGAATTACGAGCAAAGCATGCACAACAGCAACAAGTTATTCGAAAGATTGTCCAGTTTATTGTTACA
TTGGTTCAAAATAACCAACTTGTGAGTTTAAAACGTAAAAGGCCTCTACTTCTAAACACTAATGGAGCC
CAAAAGAAGAACCTGTTTCAGCACATAGTCAAAGAACCAACTGATAATCATCATCATAAAGTAATTTTT
TAG

Restriction Sites SgfI-MluI     
ACCN NM_001243094
Insert Size 693 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243094.1
RefSeq Size 1088 bp
RefSeq ORF 693 bp
Locus ID 3298
Protein Families Transcription Factors
MW 27 kDa
Gene Summary The protein encoded by this gene belongs to the HSF family of transcription factors that bind specifically to the heat-shock promoter element and activate transcription. Heat shock transcription factors activate heat-shock response genes under conditions of heat or other stresses. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
Transcript Variant: This variant (3) contains a different 3' terminal exon compared to variant 1. This results in a frame-shift and a shorter isoform (c) with a distinct C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...