TAF1C (NM_001243160) Human Untagged Clone

CAT#: SC330091

TAF1C (untagged) - Homo sapiens TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa (TAF1C), transcript variant 7



  "NM_001243160" in other vectors (2)

CNY 3,710.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TAF1C Rabbit monoclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MGC:39976; SL1; TAFI95; TAFI110
Vector pCMV6-Entry
Sequence Data
>SC330091 representing NM_001243160.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTGAAGTGGAACCATGGCCTCCCCTCCCCGCTCCTGCTGGCCCGACTGCTGCCTCCGCCCCGGCCC
AGCTGCGTGCAGCCCCTGCTCCTCGGAGGCCAGGGTGGGCAGCTGCAGCTGCTGCACCTGGCAGAAGGG
GCGTCGGTGCCCCGCCTGGCAGGCCCCCCCCAGTCTCTTCCTTCCAGGATCGACTCCCTCCCTGCATTT
CCTCTGCTGGAGCCTAAGATCCAGTGGCGGCTGCAGGAGCGCCTGAAAGCACCGACCATAGGTCTGGCT
GCCGTCGTCCCGCCCTTGCCCTCAGCGCCCACACCAGGCCTGGTGCTCTTCCAGCTCTCGGCGGCGGGA
GATGTCTTCTACCAGCAGCTCCGCCCCCAGGTGGACTCCAGCCTCCGCAGAGATGCTGGGCCTCCTGGC
GACACCCAACCTGACTGCCATGCCCCCACAGCTTCCTGGACCTCCCAGGACACTGCCGGCTGCAGCCAG
TGGCTGAAGGCCCTGCTAAAAGTGCCCCTGGCTCCTCCTGTGTGGACAGCACCCACCTTCACCCACCGC
CAGATGCTGGGCAGCACAGAGCTGCGGAGGGAGGAAGAGGAAGGGCAGCGGCTGGGTGTGCTCCGCAAG
GCCATGGCCCGAGGGCAGCTCCTGCTGCAGAGAGACCTGGGCTCCCTCCCTGCGGCAGAGCCACCCCCT
GCACCCGAGTCAGGCCTAGAGGACAAGCTCAGTGAGCGCCTGGGGGAAGCCTGGGCAGGCCGAGGGGCT
GCCTGGTGGGAGAGGCAGCAGGGCAGGACCTCGGAGCCCGGGAGACAGACCAGGCGGCCCAAGCGCCGG
ACCCAGCTGTCCAGCAGCTTTTCGCTCAGTGGCCATGTGGATCCCTCAGAGGACACCAGCTCCCCTCAT
AGCCCTGAGTGGCCACCTGCTGATGCTCTGCCCCTGCCCCCCACGACCCCGCCCTCCCAGGAGTTGACT
CCGGATGCATGCGCCCAGGGCGTCCCATCAGAGCAGCGGCAGATGCTCCGTGACTACATGGCCAAGCTA
CCACCCCAGAGGGACACCCCAGGCTGTGCCACCACACCTCCCCACTCCCAGGCCTCCAGCGTCCGGGCC
ACTCGCTCCCAGCAGCACACACCCGTCCTCTCTAGCTCTCAGCCCCTCCGGAAGAAGCCTCGAATGGGC
TTCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243160
Insert Size 1179 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243160.1
RefSeq Size 3696 bp
RefSeq ORF 1179 bp
Locus ID 9013
Protein Families Transcription Factors
MW 42.6 kDa
Gene Summary Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes the largest SL1-specific TAF. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2011]
Transcript Variant: This variant (7) differs in several regions and has a downstream AUG start codon, compared to variant 1. The resulting isoform (6) is much shorter at the N-terminus and lacks an internal amino acid 'G', compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...