NARS2 (NM_001243251) Human Untagged Clone
CAT#: SC330107
NARS2 (untagged) - Homo sapiens asparaginyl-tRNA synthetase 2, mitochondrial (putative) (NARS2), transcript variant 2
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | asnRS; DFNB94; SLM5 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330107 representing NM_001243251.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCAGGAGCTTTTACTCAAGTGTTTACCTTTGGTCCGACCTTCCGAGCTGAAAATTCTCAGAGCCGG AGGCACCTGGCAGAGTTTTATATGATAGAAGCAGAGATTTCTTTTGTTGACAGCCTTCAAGATCTTATG CAGGTTATAGAGGAACTGTTCAAGGCTACAACAATGATGGTTCTCTCAAAATGTCCTGAAGATGTTGAA CTCTGTCACAAATTCATAGCACCTGGCCAAAAGGACAGATTAGAACATATGCTAAAAAACAACTTTTTA ATCATTTCTTATACTGAAGCAGTGGAGATCTTAAAGCAAGCATCCCAGAACTTCACCTTTACCCCAGAG TGGGGTGCTGACCTACGGACTGAACATGAAAAGTACCTGGTGAAGCACTGTGGCAACATACCTGTCTTC GTTATTAATTATCCATTAACACTCAAGCCTTTCTACATGAGGGATAATGAAGATGGCCCTCAGCACACG GTTGCTGCTGTTGATCTTCTGGTTCCTGGAGTTGGGGAACTCTTTGGAGGAGGCCTCAGAGAAGAACGA TACCATTTCTTAGAGGAGCGCTTAGCCAGATCGGGACTTACAGAAGTCTACCAATGGTATCTGGACCTT CGTCGATTTGGATCTGTGCCACATGGAGGTTTTGGGATGGGATTTGAACGCTACCTGCAGTGCATCTTG GGTGTTGACAATATCAAAGATGTTATCCCTTTCCCAAGGTTTCCTCATTCATGCCTTTTATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243251 |
Insert Size | 753 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001243251.1 |
RefSeq Size | 2038 bp |
RefSeq ORF | 753 bp |
Locus ID | 79731 |
UniProt ID | Q96I59 |
Protein Pathways | Aminoacyl-tRNA biosynthesis |
MW | 28.8 kDa |
Gene Summary | This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of asparagine to tRNA molecules. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency 24 (COXPD24). [provided by RefSeq, Mar 2015] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and uses a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232285 | NARS2 (Myc-DDK tagged) - Homo sapiens asparaginyl-tRNA synthetase 2, mitochondrial (putative) (NARS2), transcript variant 2 |
CNY 3,990.00 |
|
RG232285 | NARS2 (tGFP-tagged) - Homo sapiens asparaginyl-tRNA synthetase 2, mitochondrial (putative) (NARS2), transcript variant 2 |
CNY 4,370.00 |