Arginase 1 (ARG1) (NM_001244438) Human Untagged Clone

CAT#: SC330211

ARG1 (untagged) - Homo sapiens arginase 1 (ARG1), transcript variant 1



  "NM_001244438" in other vectors (2)

CNY 3,230.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
ARG1 (liver Arginase) mouse monoclonal antibody, clone OTI4E6 (formerly 4E6)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC330211 representing NM_001244438.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCGCCAAGTCCAGAACCATAGGGATTATTGGAGCTCCTTTCTCAAAGGGACAGCCACGAGGAGGG
GTGGAAGAAGGCCCTACAGTATTGAGAAAGGCTGGTCTGCTTGAGAAACTTAAAGAACAAGTAACTCAA
AACTTTTTAATTTTAGAGTGTGATGTGAAGGATTATGGGGACCTGCCCTTTGCTGACATCCCTAATGAC
AGTCCCTTTCAAATTGTGAAGAATCCAAGGTCTGTGGGAAAAGCAAGCGAGCAGCTGGCTGGCAAGGTG
GCAGAAGTCAAGAAGAACGGAAGAATCAGCCTGGTGCTGGGCGGAGACCACAGTTTGGCAATTGGAAGC
ATCTCTGGCCATGCCAGGGTCCACCCTGATCTTGGAGTCATCTGGGTGGATGCTCACACTGATATCAAC
ACTCCACTGACAACCACAAGTGGAAACTTGCATGGACAACCTGTATCTTTCCTCCTGAAGGAACTAAAA
GGAAAGATTCCCGATGTGCCAGGATTCTCCTGGGTGACTCCCTGTATATCTGCCAAGGATATTGTGTAT
ATTGGCTTGAGAGACGTGGACCCTGGGGAACACTACATTTTGAAAACTCTAGGCATTAAATACTTTTCA
ATGACTGAAGTGGACAGACTAGGAATTGGCAAGGTGATGGAAGAAACACTCAGCTATCTACTAGGAAGA
AAGAAAAGGCCAATTCATCTAAGTTTTGATGTTGACGGACTGGACCCATCTTTCACACCAGCTACTGGC
ACACCAGTCGTGGGAGGTCTGACATACAGAGAAGGTCTCTACATCACAGAAGAAATCTACAAAACAGGG
CTACTCTCAGGATTAGATATAATGGAAGTGAACCCATCCCTGGGGAAGACACCAGAAGAAGTAACTCGA
ACAGTGAACACAGCAGTTGCAATAACCTTGGCTTGTTTCGGACTTGCTCGGGAGGGTAATCACAAGCCT
ATTGACTACCTTAACCCACCTAAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001244438
Insert Size 993 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001244438.1
RefSeq Size 1499 bp
RefSeq ORF 993 bp
Locus ID 383
UniProt ID P05089
Protein Families Druggable Genome
Protein Pathways Arginine and proline metabolism, Metabolic pathways
MW 35.7 kDa
Gene Summary Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exist (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type I isoform encoded by this gene, is a cytosolic enzyme and expressed predominantly in the liver as a component of the urea cycle. Inherited deficiency of this enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (1, also known as erythroid variant) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...