NT5C (NM_001252377) Human Untagged Clone

CAT#: SC330285

NT5C (untagged) - Homo sapiens 5', 3'-nucleotidase, cytosolic (NT5C), transcript variant 2



  "NM_001252377" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
NT5C Antibody - C-terminal region
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms cdN; DNT; dNT-1; DNT1; HEL74; P5N2; PN-I; PN-II; UMPH2
Vector pCMV6-Entry
Sequence Data
>SC330285 representing NM_001252377.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGCGGAGCGTGCGCGTGCTGGTGGACATGGACGGCGTCCTGGCCGACTTCGAGGCCGGCCTCCTG
CGGGGCTTCCGCCGCCGCTTCCCTGAGGAGCCGCACGTGCCGCTGGAGCAACGCCGCGGCTTCCTGGCC
CGCGAGCAGTACCGCGCCCTGCGGCCCGACCTGGCGGATAAAGTGGCCAGTGTGTACGAAGCCCCGGGC
TTTTTCCTGGACCTGGAGCCCATCCCGGGAGCCTTGGACGCTGTGCGGGAGATGAACGACCTACCGGAC
ACGCAGGTCTTCATCTGCACCAGCCCCCTGCTGAAGTACCACCACTGTGTGGGTGAGAAGGAGGAGACC
CCAAGCTGGGAGCACATCTTGTTCACCTGCTGCCACAATCGGCACCTGGTCCTGCCCCCGACAAGGAGA
CGGCTGCTCTCCTGGAGTGACAACTGGAGGGAGATCTTAGATAGCAAGCGCGGAGCTGCGCAGCGGGAA
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001252377
Insert Size 486 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001252377.1
RefSeq Size 855 bp
RefSeq ORF 486 bp
Locus ID 30833
UniProt ID Q8TCD5
Protein Families Transcription Factors
Protein Pathways Metabolic pathways, Nicotinate and nicotinamide metabolism, Purine metabolism, Pyrimidine metabolism
MW 18.7 kDa
Gene Summary This gene encodes a nucleotidase that catalyzes the dephosphorylation of the 5' deoxyribonucleotides (dNTP) and 2'(3')-dNTP and ribonucleotides, but not 5' ribonucleotides. Of the different forms of nucleotidases characterized, this enzyme is unique in its preference for 5'-dNTP. It may be one of the enzymes involved in regulating the size of dNTP pools in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (2) lacks an in-frame coding exon, and uses an alternate in-frame acceptor splice site at the 3' terminal exon compared to variant 1. This results in a shorter isoform (2) missing an internal protein segment compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...