CTHRC1 (NM_001256099) Human Untagged Clone

CAT#: SC330365

CTHRC1 (untagged) - Homo sapiens collagen triple helix repeat containing 1 (CTHRC1), transcript variant 2



  "NM_001256099" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CTHRC1 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC330365 representing NM_001256099.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTGGCCGCCAGGTAGGAGCATCACAGTCAAGCTACGGGAGAAAACAGTTTCCAGGAAACTGGAAATG
AACGGCCCGAGTGCTTTCCAGGGGCTCATCTGTGGGAAGTATAATGGAATGTGCTTACAAGGGCCAGCA
GGAGTGCCTGGTCGAGACGGGAGCCCTGGGGCCAATGGCATTCCGGGTACACCTGGGATCCCAGGTCGG
GATGGATTCAAAGGAGAAAAGGGGGAATGTCTGAGGGAAAGCTTTGAGGAGTCCTGGACACCCAACTAC
AAGCAGTGTTCATGGAGTTCATTGAATTATGGCATAGATCTTGGGAAAATTGCGGAGTGTACATTTACA
AAGATGCGTTCAAATAGTGCTCTAAGAGTTTTGTTCAGTGGCTCACTTCGGCTAAAATGCAGAAATGCA
TGCTGTCAGCGTTGGTATTTCACATTCAATGGAGCTGAATGTTCAGGACCTCTTCCCATTGAAGCTATA
ATTTATTTGGACCAAGGAAGCCCTGAAATGAATTCAACAATTAATATTCATCGCACTTCTTCTGTGGAA
GGACTTTGTGAAGGAATTGGTGCTGGATTAGTGGATGTTGCTATCTGGGTTGGTACTTGTTCAGATTAC
CCAAAAGGAGATGCTTCTACTGGATGGAATTCAGTTTCTCGCATCATTATTGAAGAACTACCAAAATAA

Restriction Sites SgfI-MluI     
ACCN NM_001256099
Insert Size 690 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256099.1
RefSeq Size 1214 bp
RefSeq ORF 690 bp
Locus ID 115908
UniProt ID Q96CG8
Protein Families Secreted Protein
MW 24.8 kDa
Gene Summary This locus encodes a protein that may play a role in the cellular response to arterial injury through involvement in vascular remodeling. Mutations at this locus have been associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (2) differs in the 5' UTR, contains an alternate in-frame 5' terminal exon, and uses an alternate start codon, compared to variant 1. Isoform 2 has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...