Nkx3.1 (NKX3-1) (NM_001256339) Human Untagged Clone

CAT#: SC330398

NKX3 (untagged) - Homo sapiens NK3 homeobox 1 (NKX3-1), transcript variant 2



  "NM_001256339" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
NKX3.1 mouse monoclonal antibody, clone OTI6E7 (formerly 6E7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BAPX2; NKX3; NKX3.1; NKX3A
Vector pCMV6-Entry
Sequence Data
>SC330398 representing NM_001256339.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTCAGGGTTCCGGAGCCGCGGCCCGGGGAGGCCGAGACGCTGGCAGAGACCGAGCCAGAAAGGCAC
TTGGGGTCTTATCTGTTGGACTCTGAAAACACTTCAGGCGCCCTTCCAAGGCTTCCCCAAACCCCTAAG
CAGCCGCAGAAGCGCTCCCGAGCTGCCTTCTCCCACACTCAGGTGATCGAGTTGGAGAGGAAGTTCAGC
CATCAGAAGTACCTGTCGGCCCCTGAACGGGCCCACCTGGCCAAGAACCTCAAGCTCACGGAGACCCAA
GTGAAGATATGGTTCCAGAACAGACGCTATAAGACTAAGCGAAAGCAGCTCTCCTCGGAGCTGGGAGAC
TTGGAGAAGCACTCCTCTTTGCCGGCCCTGAAAGAGGAGGCCTTCTCCCGGGCCTCCCTGGTCTCCGTG
TATAACAGCTATCCTTACTACCCATACCTGTACTGCGTGGGCAGCTGGAGCCCAGCTTTTTGGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001256339
Insert Size 480 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256339.1
RefSeq Size 3024 bp
RefSeq ORF 480 bp
Locus ID 4824
UniProt ID Q99801
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Pathways in cancer, Prostate cancer
MW 18.4 kDa
Gene Summary This gene encodes a homeobox-containing transcription factor. This transcription factor functions as a negative regulator of epithelial cell growth in prostate tissue. Aberrant expression of this gene is associated with prostate tumor progression. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (2) lacks a segment in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 2, which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...