ELOVL1 (NM_001256399) Human Untagged Clone

CAT#: SC330412

ELOVL1 (untagged) - Homo sapiens ELOVL fatty acid elongase 1 (ELOVL1), transcript variant 2



  "NM_001256399" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ELOVL1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-88; IKSHD; Ssc1
Vector pCMV6-Entry
Sequence Data
>SC330412 representing NM_001256399.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGGCTGTTGTGAACTTGTACCAAGAGGTGATGAAGCACGCAGATCCCCGGATCCAGGGCTACCCT
CTGATGGGGTCCCCCTTGCTAATGACCTCCATTCTCCTGACCTACGTGTACTTCGTTCTCTCACTTGGG
CCTCGCATCATGGCTAATCGGAAGCCCTTCCAGCTCCGTGGCTTCATGATTGTCTACAACTTCTCACTG
GTGGCACTCTCCCTCTACATTGTCTATGAGTTCCTGATGTCGGGCTGGCTGAGCACCTATACCTGGCGC
TGTGACCCTGTGGACTATTCCAACAGCCCTGAGGCACTTAGGATGGTTCGGGTGGCCTGGCTCTTCCTC
TTCTCCAAGTTCATTGAGCTGATGGACACAGTGATCTTTATTCTCCGAAAGAAAGACGGGCAGGTGACC
TTCCTACATGTCTTCCATCACTCTGTGCTTCCCTGGAGCTGGTGGTGGGGGGTAAAGATTGCCCCGGGA
GGAATGGGCTCTTTCCATGCCATGATAAACTCTTCCGTGCATGTCATAATGTACCTGTACTACGGATTA
TCTGCCTTTGGCCCTGTGGCACAACCCTACCTTTGGTGGAAAAAGCACATGACAGCCATTCAGCTGATC
CAGTTTGTCCTGGTCTCACTGCACATCTCCCAGTACTACTTTATGTCCAGCTGTAACTACCAGTACCCA
GTCATTATTCACCTCATCTGGATGTATGGCACCATCTTCTTCATGCTGTTCTCCAACTTCTGGTATCAC
TCTTATACCAAGGGCAAGCGGCTGCCCCGTGCACTTCAGCAAAATGGAGCTCCAGGTATTGCCAAGGTC
AAGGCCAACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256399
Insert Size 840 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256399.1
RefSeq Size 1631 bp
RefSeq ORF 840 bp
Locus ID 64834
UniProt ID Q9BW60
Protein Families Transmembrane
MW 32.7 kDa
Gene Summary Catalyzes the first and rate-limiting reaction of the four reactions that constitute the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids (VLCFAs) per cycle. Condensing enzyme that exhibits activity toward saturated and monounsaturated acyl-CoA substrates, with the highest activity towards C22:0 acyl-CoA. May participate in the production of both saturated and monounsaturated VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators. Important for saturated C24:0 and monounsaturated C24:1 sphingolipid synthesis. Indirectly inhibits RPE65 via production of VLCFAs.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses a different 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...