DCSTAMP (NM_001257317) Human Untagged Clone

CAT#: SC330595

DCSTAMP (untagged) - Homo sapiens dendrocyte expressed seven transmembrane protein (DCSTAMP), transcript variant 2



  "NM_001257317" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-DCSTAMP Antibody
    • 50 ug

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FIND; hDC-STAMP; TM7SF4
Vector pCMV6-Entry
Sequence Data
>SC330595 representing NM_001257317.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGTATCTGGACCTCAGGCACTGATATCTTCCTAAGTCTTTGGGAGATTTACGTGTCTCCAAGAAGC
CCCGGATGGATGGACTTTATCCAGCATTTGGGAGTTTGCTGTTTGGTTGCTCTTATTTCAGTGGGCCTC
CTGTCTGTGGCCGCCTGCTGGTTTCTGCCATCAATCATAGCGGCCGCTGCCTCCTGGATTATCACGTGT
GTTCTGCTGTGTTGCTCCAAGCATGCACGATGTTTTATTCTTCTTGTCTTTCTCTCTTGTGGCCTGCGT
GAAGGCAGGAATGCTTTGATTGCAGCTGGCACAGGGATCGTCATCTTGGGACACGTAGAAAATATTTTT
CACAACTTTAAAGGTCTCCTAGATGGTATGACTTGCAACCTAAGGGCAAAGAGCTTTTCCATACATTTT
CCACTTTTGAAAAAATATATTGAGGCAATTCAGTGGATTTATGGCCTTGCCACTCCACTAAGTGTATTT
GATGACCTTGTTTCTTGGAACCAGACCCTGGCAGTCTCTCTTTTCAGTCCCAGCCATGTCCTGGAGGCA
CAGCTAAATGACAGCAAAGGGGAAGTCCTGAGCGTCTTGTACCAGATGGCAACAACCACAGAGGTGTTG
TCCTCCCTGGGTCAGAAGCTACTTGCCTTTGCAGGGCTTTCGCTCGTCCTGCTTGGCACTGGCCTCTTC
ATGAAGCGATTTTTGGGCCCTTGTGGTTGGAAGTATGAAAACATCTACATCACCAGACAATTTGTTCAG
TTTGATGAAAGGGAGAGACATCAACAGAGGCCCTGTGTGCTCCCGCTGAATAAGGAGGAAAGGAGGAAA
TTCATTTCTGGCTTCCAGTCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001257317
Insert Size 852 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257317.1
RefSeq Size 1498 bp
RefSeq ORF 852 bp
Locus ID 81501
UniProt ID Q9H295
Protein Families Druggable Genome, Transmembrane
MW 31.6 kDa
Gene Summary This gene encodes a seven-pass transmembrane protein that is primarily expressed in dendritic cells. The encoded protein is involved in a range of immunological functions carried out by dendritic cells. This protein plays a role in osteoclastogenesis and myeloid differentiation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (2) lacks an exon in the coding region and uses an alternate splice site which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...