KCTD1 (NM_001258221) Human Untagged Clone
CAT#: SC330646
KCTD1 (untagged) - Homo sapiens potassium channel tetramerization domain containing 1 (KCTD1), transcript variant 4
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C18orf5 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330646 representing NM_001258221.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCAAGACCTCTGATCACTAGATCCCCTGCATCTCCACTGAACAACCAAGGCATCCCTACTCCAGCA CAACTCACAAAATCCAATGCGCCTGTCCACATTGATGTGGGCGGCCACATGTACACCAGCAGCCTGGCC ACCCTCACCAAATACCCTGAATCCAGAATCGGAAGACTTTTTGATGGTACAGAGCCCATTGTTTTGGAC AGTCTCAAACAGCACTATTTCATTGACAGAGATGGACAGATGTTCAGATATATCTTGAATTTTCTACGA ACATCCAAACTCCTCATTCCTGATGATTTCAAGGACTACACTTTGTTATATGAAGAGGCAAAATATTTT CAGCTTCAGCCCATGTTGTTGGAGATGGAAAGATGGAAGCAGGACAGAGAAACTGGTCGATTTTCAAGG CCCTGTGAGTGCCTCGTCGTGCGTGTGGCCCCAGACCTCGGAGAAAGGATCACGCTAAGCGGTGACAAA TCCTTGATAGAAGAAGTATTTCCAGAGATCGGCGACGTGATGTGTAACTCTGTCAATGCAGGCTGGAAT CACGACTCGACGCACGTCATCAGGTTTCCACTAAATGGCTACTGTCACCTCAACTCAGTCCAGGTCCTC GAGAGGTTGCAGCAAAGAGGATTTGAAATCGTGGGCTCCTGTGGGGGAGGAGTAGACTCGTCCCAGTTC AGCGAATACGTCCTTCGGCGGGAACTGAGGCGGACGCCCCGTGTACCCTCCGTCATCCGGATAAAGCAA GAGCCTCTGGACTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001258221 |
Insert Size | 774 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001258221.1 |
RefSeq Size | 1715 bp |
RefSeq ORF | 774 bp |
Locus ID | 284252 |
UniProt ID | Q719H9 |
Protein Families | Ion Channels: Other |
MW | 29.4 kDa |
Gene Summary | This gene encodes a protein containing a BTB (Broad-complex, tramtrack and bric a brac), also known as a POZ (POxvirus and zinc finger) protein-protein interaction domain. The encoded protein negatively regulates the AP-2 family of transcription factors and the Wnt signaling pathway. A mechanism for the modulation of Wnt signaling has been proposed in which the encoded protein enhances ubiquitination and degradation of the beta-catenin protein. Mutations in this gene have been identified in Scalp-ear-nipple (SEN) syndrome. [provided by RefSeq, May 2017] Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 3. Variants 1, 2, 4 and 6 all encode the same isoform (a), which has a shorter N-terminus compared to isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232304 | KCTD1 (Myc-DDK tagged) - Homo sapiens potassium channel tetramerization domain containing 1 (KCTD1), transcript variant 4 |
CNY 2,400.00 |
|
RG232304 | KCTD1 (tGFP-tagged) - Homo sapiens potassium channel tetramerization domain containing 1 (KCTD1), transcript variant 4 |
CNY 4,370.00 |