Selenium Binding Protein 1 (SELENBP1) (NM_001258288) Human Untagged Clone

CAT#: SC330656

SELENBP1 (untagged) - Homo sapiens selenium binding protein 1 (SELENBP1), transcript variant 2



  "NM_001258288" in other vectors (2)

CNY 3,900.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
SELENBP1 (Selenium Binding Protein 1) mouse monoclonal antibody, clone OTI3A3 (formerly 3A3)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EHMTO; HEL-S-134P; hSBP; LPSB; MTO; SBP56; SP56
Vector pCMV6-Entry
Sequence Data
>SC330656 representing NM_001258288.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTACGAAATGTGGGAATTGTGGACCCGGCTACTCCACCCCTCTGGAGGCCATGAAAGGACCCAGG
GAAGAGATCGTCTACCTGCCCTGCATTTACCGAAACACAGGCACTGAGGCCCCAGATTATCTGGCCACT
GTGGATGTTGACCCCAAGTCTCCCCAGTATTGCCAGGTCATTGAGCCCAAGGACATCCATGCCAAGTGC
GAACTGGCCTTTCTCCACACCAGCCACTGCCTGGCCAGCGGGGAAGTGATGATCAGCTCCCTGGGAGAC
GTCAAGGGCAATGGCAAAGGGGGTTTTGTGCTGCTGGATGGGGAGACGTTCGAGGTGAAGGGGACATGG
GAGAGACCTGGGGGTGCTGCACCGTTGGGCTATGACTTCTGGTACCAGCCTCGACACAATGTCATGATC
AGCACTGAGTGGGCAGCTCCCAATGTCTTACGAGATGGCTTCAACCCCGCTGATGTGGAGGCTGGACTG
TACGGGAGCCACTTATATGTATGGGACTGGCAGCGCCATGAGATTGTGCAGACCCTGTCTCTAAAAGAT
GGGCTTATTCCCTTGGAGATCCGCTTCCTGCACAACCCAGACGCTGCCCAAGGCTTTGTGGGCTGCGCA
CTCAGCTCCACCATCCAGCGCTTCTACAAGAACGAGGGAGGTACATGGTCAGTGGAGAAGGTGATCCAG
GTGCCCCCCAAGAAAGTGAAGGGCTGGCTGCTGCCCGAAATGCCAGGCCTGATCACCGACATCCTGCTC
TCCCTGGACGACCGCTTCCTCTACTTCAGCAACTGGCTGCATGGGGACCTGAGGCAGTATGACATCTCT
GACCCACAGAGACCCCGCCTCACAGGACAGCTCTTCCTCGGAGGCAGCATTGTTAAGGGAGGCCCTGTG
CAAGTGCTGGAGGACGAGGAACTAAAGTCCCAGCCAGAGCCCCTAGTGGTCAAGGGAAAACGGGTGGCT
GGAGGCCCTCAGATGATCCAGCTCAGCCTGGATGGGAAGCGCCTCTACATCACCACGTCGCTGTACAGT
GCCTGGGACAAGCAGTTTTACCCTGATCTCATCAGGGAAGGCTCTGTGATGCTGCAGGTTGATGTAGAC
ACAGTAAAAGGAGGGCTGAAGTTGAACCCCAACTTCCTGGTGGACTTCGGGAAGGAGCCCCTTGGCCCA
GCCCTTGCCCATGAGCTCCGCTACCCTGGGGGCGATTGTAGCTCTGACATCTGGATTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001258288
Insert Size 1233 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001258288.1
RefSeq Size 1582 bp
RefSeq ORF 1233 bp
Locus ID 8991
UniProt ID Q13228
MW 45.5 kDa
Gene Summary This gene encodes a member of the selenium-binding protein family. Selenium is an essential nutrient that exhibits potent anticarcinogenic properties, and deficiency of selenium may cause certain neurologic diseases. The effects of selenium in preventing cancer and neurologic diseases may be mediated by selenium-binding proteins, and decreased expression of this gene may be associated with several types of cancer. The encoded protein may play a selenium-dependent role in ubiquitination/deubiquitination-mediated protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (2) lacks an exon in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Selenium Binding Protein 1产品

Customer Reviews 
Loading...