GABRR1 (NM_001267582) Human Untagged Clone

CAT#: SC330765

GABRR1 (untagged) - Homo sapiens gamma-aminobutyric acid (GABA) A receptor, rho 1 (GABRR1), transcript variant 4



  "NM_001267582" in other vectors (2)

CNY 3,710.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-GABRR1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC330765 representing NM_001267582.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGGCCTGGCTTTGGAGGCCCTGCCATTCCTGTTGGTGTGGATGTGCAGGTGGAGAGTTTGGATAGC
ATCTCAGAGGTTGACATGGACTTTACGATGACCCTCTACCTGAGGCACTACTGGAAGGACGAGAGGCTG
TCTTTTCCAAGCACCAACAACCTCAGCATGACGTTTGACGGCCGGCTGGTCAAGAAGATCTGGGTCCCT
GACATGTTTTTCGTGCACTCCAAACGCTCCTTCATCCACGACACCACCACAGACAACGTCATGTTGCGG
GTCCAGCCTGATGGGAAAGTGCTCTATAGTCTCAGGGTTACAGTAACTGCAATGTGCAACATGGACTTC
AGCCGATTTCCCTTGGACACACAAACGTGCTCTCTTGAAATTGAAAGCTATGCCTATACAGAAGATGAC
CTCATGCTGTACTGGAAAAAGGGCAATGACTCCTTAAAGACAGATGAACGGATCTCACTCTCCCAGTTC
CTCATTCAGGAATTCCACACCACCACCAAACTGGCTTTCTACAGCAGCACAGGCTGGTACAACCGTCTC
TACATTAATTTCACGTTGCGTCGCCACATCTTCTTCTTCTTGCTCCAAACTTATTTCCCCGCTACCCTG
ATGGTCATGCTGTCCTGGGTGTCCTTCTGGATCGACCGCAGAGCCGTGCCTGCCAGAGTCCCCTTAGGT
ATCACAACGGTGCTGACCATGTCCACCATCATCACGGGCGTGAATGCCTCCATGCCGCGCGTCTCCTAC
ATCAAGGCCGTGGACATCTACCTCTGGGTCAGCTTTGTGTTCGTGTTCCTCTCGGTGCTGGAGTATGCG
GCCGTCAACTACCTGACCACTGTGCAGGAGAGGAAGGAACAGAAGCTGCGGGAGAAGCTTCCCTGCACC
AGCGGATTACCTCCGCCCCGCACTGCGATGCTGGACGGCAACTACAGTGATGGGGAGGTGAATGACCTG
GACAACTACATGCCAGAGAATGGAGAGAAGCCCGACAGGATGATGGTGCAGCTGACCCTGGCCTCAGAG
AGGAGCTCCCCACAGAGGAAAAGTCAGAGAAGCAGCTATGTGAGCATGAGAATCGACACCCACGCCATT
GATAAATACTCCAGGATCATCTTTCCAGCAGCATACATTTTATTCAATTTAATATACTGGTCTATTTTC
TCCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001267582
Insert Size 1179 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001267582.1
RefSeq Size 2944 bp
RefSeq ORF 1179 bp
Locus ID 2569
UniProt ID P24046
Protein Families Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
MW 45.5 kDa
Gene Summary GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. GABRR1 is a member of the rho subunit family. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (4) contains several upstream and one downstream exon in place of the first exon compared to variant 1. The resulting isoform (c) is shorter at the N-terminus compared to isoform a. Variants 3 and 4 both encode the same isoform (c). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...