RPS3A (NM_001267699) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	FTE1; MFTL; S3A
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330778 representing NM_001267699. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCGGTTGGCAAGAACAAGCGCCTTACGAAAGGCGGCAAAAAGGGAGCCAAGAAGAAAGTGGTTGAT CCATTTTCTAAGAAAGATTGGTATGATGTGAAAGCACCTGCTATGTTCAATATAAGAAATATTGGAAAG ACGCTCGTCACCAGGACCCAAGGAACCAACAATGATTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001267699
Insert Size	177 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001267699.1
RefSeq Size	1581 bp
RefSeq ORF	177 bp
Locus ID	6189
Protein Pathways	Ribosome
MW	6.5 kDa
Gene Summary	Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S3AE family of ribosomal proteins. It is located in the cytoplasm. Disruption of the gene encoding rat ribosomal protein S3a, also named v-fos transformation effector protein, in v-fos-transformed rat cells results in reversion of the transformed phenotype. This gene is co-transcribed with the U73A and U73B small nucleolar RNA genes, which are located in its fourth and third introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012] Transcript Variant: This variant (2) lacks an internal coding exon and differs at the 3' end compared to variant 1, which results in a frame-shift, and a shorter isoform (2) with a distinct C-terminus compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.