WTAP (NM_001270533) Human Untagged Clone

CAT#: SC330859

WTAP (untagged) - Homo sapiens Wilms tumor 1 associated protein (WTAP), transcript variant 6



  "NM_001270533" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
WTAP mouse monoclonal antibody, clone OTI12G7
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Mum2
Vector pCMV6-Entry
Sequence Data
>SC330859 representing NM_001270533.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACCAACGAAGAACCTCTTCCCAAGAAGGTTCGATTGAGTGAAACAGACTTCAAAGTTATGGCAAGA
GATGAGTTAATTCTAAGATGGAAACAATATGAAGCATATGTACAAGCTTTGGAGGGCAAGTACACAGAT
CTTAACTCTAATGATGTAACTGGCCTAAGAGAGTCTGAAGAAAAACTAAAGCAACAACAGCAGGAGTCT
GCACGCAGGGAAAACATCCTTGTAATGCGACTAGCAACCAAGGAACAAGAGATGCAAGAGTGTACTACT
CAAATCCAGTACCTCAAGCAAGTCCAGCAGCCGAGCGTTGCCCAACTGAGATCAACAATGGTAGACCCA
GCGATCAACTTGTTTTTCCTAAAAATGAAAGGTGAACTGGAACAGACTAAAGACAAACTGGAACAAGCC
CAAAATGAACTGAGTGCCTGGAAGTTTACGCCTGATAGAGGCCTGATGGCGTCGGACTATTCCGAAGAA
GTGGCCACCTCCGAAAAATTCCCCTTCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001270533
Insert Size 513 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270533.1
RefSeq Size 1504 bp
RefSeq ORF 513 bp
Locus ID 9589
UniProt ID Q15007
Protein Families Druggable Genome
MW 19.9 kDa
Gene Summary The Wilms tumor suppressor gene WT1 appears to play a role in both transcriptional and posttranscriptional regulation of certain cellular genes. This gene encodes a WT1-associating protein, which is a ubiquitously expressed nuclear protein. Like WT1 protein, this protein is localized throughout the nucleoplasm as well as in speckles and partially colocalizes with splicing factors. Alternative splicing of this gene results in several transcript variants encoding three different isoforms. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (6) has an alternate 5' and 3' end sequences compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1. Variants 5 and 6 both encode the same isoform (3).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...