zinc finger protein 138 (ZNF138) (NM_001271637) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	pHZ-32
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330947 representing NM_001271637. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGGACCACTGACATTTATGGATGTGGCCATAGAGTTCTCTTTGGAGGAGTGGCAGTGCCTGGACACT GCACAGCGGAATGTATATAGGCATGTGATGTTAGAGAACTACAGAAACCTGGTTTTCTTGGCCAGACCT GATTACCTGTCTGGAACAAGGAAAAGAGCCCTGGAATATGAAGAGACATGA
Restriction Sites	SgfI-MluI
ACCN	NM_001271637
Insert Size	189 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001271637.1
RefSeq Size	2624 bp
RefSeq ORF	189 bp
Locus ID	7697
UniProt ID	P52744
Protein Families	Transcription Factors
MW	7.4 kDa
Gene Summary	May be involved in transcriptional regulation as a repressor.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) includes an alternate exon, which results in a frameshift, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.