PSMD6 (NM_001271780) Human Untagged Clone

CAT#: SC330968

PSMD6 (untagged) - Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 (PSMD6), transcript variant 3



  "NM_001271780" in other vectors (2)

CNY 3,420.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-PSMD6 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms p42A; p44S10; Rpn7; S10; SGA-113M
Vector pCMV6-Entry
Sequence Data
>SC330968 representing NM_001271780.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAATGAGAGTAACGACTCGACAAACTATGACATGGCTCCTTACTATGAAGCCTTGTGCAAATCCCTC
GACTGGCAGATAGACGTGGACCTACTCAATAAAATGAAGAAGGCAAATGAAGATGAGTTGAAGCGTTTG
GATGAGGAGCTGGAAGATGCAGAGAAGAATCTAGGAGAGAGCGAAATTCGCGATGCAATGATGGCAAAG
GCCGAGTACCTCTGCCGGATAGGTGACAAAGAGGGAGCTCTGACAGCCTTTCGCAAGACATATGACAAA
ACTGTGGCCCTGGGTCACCGATTGGATATTGTATTCTATCTCCTTAGGATTGGCTTATTTTATATGGAT
AATGATCTCATCACACGAAACACAGAAAAGGCCAAAAGCTTAATAGAAGAAGGAGGAGACTGGGACAGG
AGAAACCGCCTAAAAGTGTATCAGGGTCTTTATTGTGTGGCTATTCGTGATTTCAAACAGGCAGCTGAA
CTCTTCCTTGACACTGTTTCAACATTTACATCCTATGAACTCATGGATTATAAAACATTTGTGACTTAT
ACTGTCTATGTCAGTATGATTGCCTTAGAAAGACCAGATCTCAGGGAAAAGGTCATTAAAGGAGCAGAG
ATTCTTGAAGTGTTGCACAGTCTTCCAGCAGTTCGGCAGTATCTGTTTTCACTCTATGAATGCCGTTAC
TCTGTTTTCTTCCAATCATTAGCGGTTGTGGAACAGGAAATGAAAAAGGACTGGCTTTTTGCCCCTCAT
TATCGATACTATGTAAGAGAAATGAGAATTCATGCATACAGTCAGCTGCTGGAATCATATAGGTCATTA
ACCCTTGGCTATATGGCAGAAGCGTTTGGTGTTGGTGTGGAATTCATTGATCAGGAACTGTCCAGGTTT
ATTGCTGCCGGGAGACTACACTGCAAAATAGATAAAGTGAATGAAATAGTAGAAACCAACAGACCTGAT
AGCAAGAACTGGCAGTACCAAGAAACTATCAAGAAAGGAGATCTGCTACTAAACAGAGTTCAAAAACTT
TCCAGAGTAATTAATATGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001271780
Insert Size 1056 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271780.1
RefSeq Size 1367 bp
RefSeq ORF 1056 bp
Locus ID 9861
UniProt ID Q15008
Protein Pathways Proteasome
MW 41.3 kDa
Gene Summary This gene encodes a member of the protease subunit S10 family. The encoded protein is a subunit of the 26S proteasome which colocalizes with DNA damage foci and is involved in the ATP-dependent degradation of ubiquinated proteins. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (3) uses an alternate 5' exon, lacks an exon in the coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...