CREB3L3 (NM_001271997) Human Untagged Clone
CAT#: SC331019
CREB3L3 (untagged) - Homo sapiens cAMP responsive element binding protein 3-like 3 (CREB3L3), transcript variant 4
CNY 3,230.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CREB-H; CREBH; HYST1481; HYTG2 |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001271997, the custom clone sequence may differ by one or more nucleotides
ATGAATACGGATTTAGCTGCTGGAAAGATGGCTTCTGCTGCCTGCTCCATGGACCCCATCGACAGCTTTG AGCTCCTGGATCTCCTGTTTGACCGGCAGGACGGCATCCTGAGACACGTGGAGCTGGGCGAGGGCTGGGG TCACGTCAAGGACCAGCAGGTCCTGCCAAACCCCGACTCTGACGACTTCCTCAGCTCCATCCTGGGCTCT GGAGACTCACTGCCCAGCTCCCCACTCTGGTCCCCCGAAGGCAGTGATAGTGGCATCTCCGAAGACCTCC CCTCCGACCCCCAGGACACCCCTCCACGCAGCGGACCAGCCACCTCCCCCGCCGGCTGCCATCCTGCCCA GCCTGGCAAGGGGCCCTGCCTCTCCTATCATCCTGGCAACTCTTGCTCCACCACAACCCCAGGGCCAGTG ATCCAAGTACCTGAAGCCTCTGTGACCATAGACCTGGAAATGTGGAGCCCAGGAGGAAGGATCTGTGCTG AGAAGCCGGCTGATCCGGTGGACCTGTCCCCACGATGCAATCTCACCGTGAAAGACCTCCTCCTTTCGGG CAGCAGTGGGGACCTGCAACAGCATCACCTGGGGGCCTCCTACCTCCTGCGACCTGGGGCTGGGCACTGT CAGGAGCTGGTGCTCACCGAGGATGAGAAGAAGCTGCTGGCTAAAGAAGGCATCACCCTGCCCACTCAGC TGCCCCTCACTAAGGATGTCAGCTTGCACTGCTCAGAATCAGGAGTTACAGAGGAAAGTCTTGCATCTCG AGAAGCAAAACCTGTCCCTCTTGGAGCAACTGAAGAAACTCCAGGCCATTGTGGTGCAGTCCACCAGCAA GTCAGCCCAGACAGGCACCTGTGTCGCAGTCCTGTTGCTGTCCTTTGCCCTCATCATCCTCCCCTCCATC AGCCCTTTTGGCCCCAACAAAACCGAGAGCCCTGGGGACTTTGCGCCTGTACGAGTGTTCTCCAGAACTT TGCACAACGATGCTGCCTCCCGCGTGGCTGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271997 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001271997.1, NP_001258926.1 |
RefSeq Size | 2517 bp |
RefSeq ORF | 1014 bp |
Locus ID | 84699 |
UniProt ID | Q68CJ9 |
Protein Families | Transcription Factors |
Protein Pathways | Huntington's disease, Melanogenesis, Prostate cancer |
Gene Summary | This gene encodes a member of the basic-leucine zipper family and the AMP-dependent transcription factor family. The encoded protein is localized to the endoplasmic reticulum and acts as a transcription factor activated by cyclic AMP stimulation. The encoded protein binds the cyclic AMP response element (CRE) and the box-B element and has been linked to acute inflammatory response, hepatocellular carcinoma, triglyceride metabolism, and hepcidin expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012] Transcript Variant: This variant (4) lacks an exon in the coding region which results in a frameshift, compared to variant 1. The encoded isoform (d) is shorter and has a distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232519 | CREB3L3 (Myc-DDK tagged) - Homo sapiens cAMP responsive element binding protein 3-like 3 (CREB3L3), transcript variant 4 |
CNY 3,990.00 |
|
RG232519 | CREB3L3 (tGFP-tagged) - Homo sapiens cAMP responsive element binding protein 3-like 3 (CREB3L3), transcript variant 4 |
CNY 4,370.00 |
其它CREB3L3产品