MOK protein kinase (MOK) (NM_001272011) Human Untagged Clone

CAT#: SC331023

MOK (untagged) - Homo sapiens MOK protein kinase (MOK), transcript variant 2



  "NM_001272011" in other vectors (2)

CNY 3,710.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
RAGE mouse monoclonal antibody,clone OTI6C12
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RAGE; RAGE-1; RAGE1; STK30
Vector pCMV6-Entry
Sequence Data
>SC331023 representing NM_001272011.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGAACTATAAAGCAATTGGCAAAATAGGAGAGGGAACGTTTTCTGAAGTTATGAAGATGCAAAGC
CTGAGAGATGGAAACTACTATGCATGTAAACAAATGAAGCAGCGCTTTGAAAGTGACAGAAAATCTGGT
TCTCTTGCACTAATATGTGAACTTATGGACATGAATATTTATGAGCTAATACGAGGGAGAAGATACCCA
TTATCAGAAAAAAAAATTATGCACTATATGTACCAGTTATGTAAGTCCCTGGATCATATTCACAGAAAT
GGAATATTTCACAGAGATGTAAAACCAGAAAATATACTAATAAAGCAGGATGTCCTGAAATTAGGGGAC
TTTGGCTCCTGCCGGAGTGTCTATTCCAAGCAGCCGTACACGGAATACATCTCCACCCGCTGGTACCGG
GCCCCGGAGTGTCTCCTCACTGATGGGTTCTACACGTACAAGATGGACCTGTGGAGCGCCGGCTGTGTG
TTCTACGAGATCGCCAGTCTGCAGCCCCTCTTTCCTGGAGTAAATGAACTGGACCAAATCTCAAAAATC
CACGATGTCATCGGCACACCCGCTCAGAAGATCCTCACCAAGTTCAAACAGTCGAGAGCTATGAATTTT
GATTTTCCTTTTAAAAAGGGATCAGGAATACCTCTACTAACAACCAATTTGTCCCCACAATGCCTCTCC
CTCCTGCACGCAATGGTGGCCTATGATCCCGATGAGAGAATCGCCGCCCACCAGGCCCTGCAGCACCCC
TACTTCCAAGAACAGAGGAAAACAGAGAAGCGGGCTCTGGGCAGCCACAGAAAAGCTGGCTTTCCGGAG
CACCCTGTGGCACCGGAACCACTCAGTAACAGCTGCCAGATTTCCAAGGAGGGCAGAAAGCAGAAACAG
TCCCTAAAGCAAGAGGAGGACCGTCCCAAGAGACGAGGACCGGCCTATGTCATGGAACTGCCCAAACTA
AAGCTTTCGGGAGTGGTCAGACTGTCGTCTTACTCCAGCCCCACGCTGCAGTCCGTGCTTGGATCTGGA
ACAAATGGAAGAGTGCCGGTGCTGAGACCCTTGAAGTGCATCCCTGCGAGCAAGAAGACAGATCCGCAG
AAGGACCTTAAGCCTGCCCCGCAGCAGTGTCGCCTGCCCACCATAGTGCGGAAAGGCGGAAGATAA

Restriction Sites SgfI-MluI     
ACCN NM_001272011
Insert Size 1170 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001272011.1
RefSeq Size 1888 bp
RefSeq ORF 1170 bp
Locus ID 5891
UniProt ID Q9UQ07
Protein Families Druggable Genome, Protein Kinase
MW 44.4 kDa
Gene Summary This gene belongs to the MAP kinase superfamily. The gene was found to be regulated by caudal type transcription factor 2 (Cdx2) protein. The encoded protein, which is localized to epithelial cells in the intestinal crypt, may play a role in growth arrest and differentiation of cells of upper crypt and lower villus regions. Multiple alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...