IRF3 (NM_001197128) Human Untagged Clone

CAT#: SC331196

IRF3 (untagged) - Homo sapiens interferon regulatory factor 3 (IRF3), transcript variant 8



  "NM_001197128" in other vectors (2)

CNY 1,320.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-IRF3 mouse monoclonal antibody, clone OTI5D2 (formerly 5D2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IIAE7
Vector pCMV6-Entry
Sequence Data
>SC331196 representing NM_001197128.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGTTGGCCCCACTCCCAGATCCGGGACCCCCAAGCCTGGCTGTAGCCCCTGAGCCCTGCCCTCAG
CCCCTGCGGAGCCCCAGCTTGGACAATCCCACTCCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTG
AAGCGGCTGTTGGTGCCGGGGGAAGATCTGATTACCTTCACGGAAGGAAGCGGACGCTCACCACGCTAT
GCCCTCTGGTTCTGTGTGGGGGAGTCATGGCCCCAGGACCAGCCGTGGACCAAGAGGCTCGTGATGGTC
AAGGTTGTGCCCACGTGCCTCAGGGCCTTGGTAGAAATGGCCCGGGTAGGGGGTGCCTCCTCCCTGGAG
AATACTGTGGACCTGCACATTTCCAACAGCCACCCACTCTCCCTCACCTCCGACCAGTACAAGGCCTAC
CTGCAGGACTTGGTGGAGGGCATGGATTTCCAGGGCCCTGGGGAGAGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001197128
Insert Size 465 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001197128.1
RefSeq Size 900 bp
RefSeq ORF 465 bp
Locus ID 3661
UniProt ID Q14653
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Cytosolic DNA-sensing pathway, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway
MW 16.7 kDa
Gene Summary This gene encodes a member of the interferon regulatory transcription factor (IRF) family. The encoded protein is found in an inactive cytoplasmic form that upon serine/threonine phosphorylation forms a complex with CREBBP. This complex translocates to the nucleus and activates the transcription of interferons alpha and beta, as well as other interferon-induced genes. The protein plays an important role in the innate immune response against DNA and RNA viruses. Mutations in this gene are associated with Encephalopathy, acute, infection-induced, herpes-specific, 7. [provided by RefSeq, Sep 2020]
Transcript Variant: This variant (8, also known as IRF3b) lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. This variant also lacks an in-frame exon compared to variant 1. The encoded isoform (6) is shorter than isoform 1. Both variants 7 and 8 encode the same isoform (6).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...