PMF1 (NM_001199654) Human Untagged Clone

CAT#: SC331336

PMF1 (untagged) - Homo sapiens polyamine-modulated factor 1 (PMF1), transcript variant 1



  "NM_001199654" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PMF1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC331336 representing NM_001199654.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCGAAGCAAGTAGCGCCAATCTAGGCAGCGGCTGTGAGGAAAAAAGGCATGAGGGGTCGTCTTCG
GAATCTGTGCCACCCGGCACTACCATTTCGAGGGTGAAGCTCCTCGACACCATGGTGGACACTTTTCTT
CAGAAGCTGGTCGCCGCCGGCAGCTCTCCACTCCTTCATTGGGACGGAAGTGCTGGTCCCCGCCTGCCC
TCTGGTGGACAGTCTGTGAAACAGGCCTTCAGTTGGGCGGCGTGCAGGTTACCACAGGGGAGGAAGGAG
GAAATCTCTGACATCAAAGAGGAGGGGAACCTAGAAGCTGTCTTGAATGCCTTGGATAAAATTGTGGAA
GAAGGCAAAGTCCGCAAAGAGCCAGCCTGGCGCCCCAGCGGGATCCCAGAGAAGGATCTGCACAGTGTT
ATGGCACCCTACTTCCTGCAGCAACGGGACACCCTGCGGCGCCATGTGCAGAAACAGGAGGCCGAGAAC
CAGCAGCTGGCAGATGCCGTCCTGGCAGGGCGGAGGCAGGTGGAGGAGCTGCAGCTACAGGTCCAGGCC
CAGCAGCAGGCCTGGCAGGCTCTACACAGAGAACAGAGGGAGCTGGTTGCTGTGCTGAGGGAGCCTGAG
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001199654
Insert Size 624 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199654.1
RefSeq Size 1128 bp
RefSeq ORF 624 bp
Locus ID 11243
UniProt ID Q6P1K2
Protein Families Stem cell - Pluripotency
MW 22.9 kDa
Gene Summary Part of the MIS12 complex which is required for normal chromosome alignment and segregation and kinetochore formation during mitosis. May act as a cotranscription partner of NFE2L2 involved in regulation of polyamine-induced transcription of SSAT.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...