DARPP32 (PPP1R1B) (NM_001242464) Human Untagged Clone
CAT#: SC331806
PPP1R1B (untagged) - Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 1B (PPP1R1B), transcript variant 3
CNY 2,950.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DARPP-32; DARPP32 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331806 representing NM_001242464.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCTGTTCCGGCTCTCAGAGCACTCCTCACCAGAGGAGGAAGCCTCCCCCCACCAGAGAGCCTCAGGA GAGGGGCACCATCTCAAGTCGAAGAGACCCAACCCCTGTGCCTACACACCACCTTCGCTGAAAGCTGTG CAGCGCATTGCTGAGTCTCACCTGCAGTCTATCAGCAATTTGAATGAGAACCAGGCCTCAGAGGAGGAG GATGAGCTGGGGGAGCTTCGGGAGCTGGGTTATCCAAGAGAGGAAGATGAGGAGGAAGAGGAGGATGAT GAAGAAGAGGAAGAAGAAGAGGACAGCCAGGCTGAAGTCCTGAAGGTCATCAGGCAGTCTGCTGGGCAA AAGACAACCTGTGGCCAGGGTCTGGAAGGGCCCTGGGAGCGCCCACCCCCTCTGGATGAGTCCGAGAGA GATGGAGGCTCTGAGGACCAAGTGGAAGACCCAGCACTAAGTGAGCCTGGGGAGGAACCTCAGCGCCCT TCCCCCTCTGAGCCTGGCACATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242464 |
Insert Size | 507 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001242464.1 |
RefSeq Size | 1446 bp |
RefSeq ORF | 507 bp |
Locus ID | 84152 |
UniProt ID | Q9UD71 |
Protein Families | Druggable Genome |
MW | 18.7 kDa |
Gene Summary | This gene encodes a bifunctional signal transduction molecule. Dopaminergic and glutamatergic receptor stimulation regulates its phosphorylation and function as a kinase or phosphatase inhibitor. As a target for dopamine, this gene may serve as a therapeutic target for neurologic and psychiatric disorders. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Variants 2 and 3 encode isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233348 | PPP1R1B (Myc-DDK tagged) - Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 1B (PPP1R1B), transcript variant 3 |
CNY 2,400.00 |
|
RG233348 | PPP1R1B (tGFP-tagged) - Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 1B (PPP1R1B), transcript variant 3 |
CNY 4,370.00 |
其它DARPP32产品