HLA DP (HLA-DPA1) (NM_001242525) Human Untagged Clone
CAT#: SC331823
HLA (untagged) - Homo sapiens major histocompatibility complex, class II, DP alpha 1 (HLA-DPA1), transcript variant 3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DP(W3); DP(W4); DPA1; HLA-DP1A; HLA-DPA; HLA-DPB1; HLADP; HLASB; PLT1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331823 representing NM_001242525.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCGCCCTGAAGACAGAATGTTCCATATCAGAGCTGTGATCTTGAGAGCCCTCTCCTTGGCTTTCCTG CTGAGTCTCCGAGGAGCTGGGGCCATCAAGGCGGACCATGTGTCAACTTATGCCGCGTTTGTACAGACG CATAGACCAACAGGGGAGTTTATGTTTGAATTTGATGAAGATGAGATGTTCTATGTGGATCTGGACAAG AAGGAGACCGTCTGGCATCTGGAGGAGTTTGGCCAAGCCTTTTCCTTTGAGGCTCAGGGCGGGCTGGCT AACATTGCTATATTGAACAACAACTTGAATACCTTGATCCAGCGTTCCAACCACACTCAGGCCACCAAC GATCCCCCTGAGGTGACCGTGTTTCCCAAGGAGCCTGTGGAGCTGGGCCAGCCCAACACCCTCATCTGC CACATTGACAAGTTCTTCCCACCAGTGCTCAACGTCACGTGGCTGTGCAACGGGGAGCTGGTCACTGAG GGTGTCGCTGAGAGCCTCTTCCTGCCCAGAACAGATTACAGCTTCCACAAGTTCCATTACCTGACCTTT GTGCCCTCAGCAGAGGACTTCTATGACTGCAGGGTGGAGCACTGGGGCTTGGACCAGCCGCTCCTCAAG CACTGGGAGGCCCAAGAGCCAATCCAGATGCCTGAGACAACGGAGACTGTGCTCTGTGCCCTGGGCCTG GTGCTGGGCCTAGTCGGCATCATCGTGGGCACCGTCCTCATCATAAAGTCTCTGCGTTCTGGCCATGAC CCCCGGGCCCAGGGGACCCTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242525 |
Insert Size | 783 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001242525.1 |
RefSeq Size | 1712 bp |
RefSeq ORF | 783 bp |
Locus ID | 3113 |
UniProt ID | P20036 |
Protein Families | Transmembrane |
Protein Pathways | Allograft rejection, Antigen processing and presentation, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Systemic lupus erythematosus, Type I diabetes mellitus, Viral myocarditis |
MW | 29.4 kDa |
Gene Summary | HLA-DPA1 belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DPA) and a beta (DPB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. Within the DP molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to 4 different molecules. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233578 | HLA (Myc-DDK tagged) - Homo sapiens major histocompatibility complex, class II, DP alpha 1 (HLA-DPA1), transcript variant 3 |
CNY 2,400.00 |
|
RG233578 | HLA (tGFP-tagged) - Homo sapiens major histocompatibility complex, class II, DP alpha 1 (HLA-DPA1), transcript variant 3 |
CNY 4,370.00 |