MTHFD1L (NM_001242769) Human Untagged Clone

CAT#: SC331854

MTHFD1L (untagged) - Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like (MTHFD1L), transcript variant 4



  "NM_001242769" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
MTHFD1L Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ292B18.2; FTHFSDC1; MTC1THFS
Vector pCMV6-Entry
Sequence Data
>SC331854 representing NM_001242769.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGCACGCGTCTGCCGCTCGTCCTGCGCCAGCTCCGCCGCCCGCCCCAGCCCCCGGGCCCTCCGCGC
CGCCTCCGTGTGCCCTGTCGCGCTAGCAGCGGCGGCGGCGGAGGCGGCGGCGGTGGCCGGGAGGGCCTG
CTTGGACAGCGGCGGCCGCAGGATGGCCAGGCCCGGAGCAGCTGCAGCCCCGGCGGCCGAACGCCCGCG
GCGCGGGACTCCATCGTCAGAGAAGTCATTCAGAATTCAAAAGAAGTTCTAAGTTTATTGCAAGAAAAA
AACCCTGCCTTCAAGCCGGTTCTTGCAATTATCCAGGCAGGTGACGACAACTTGATGCAGGAAATCAAC
CAGAATTTGGCTGAGGAGGCTGGTCTGAACATCACTCACATTTGCCTCCCTCCAGATAGCAGTGAAGCC
GAGATTATAGATGAAATCTTAAAGATCAATGAAGATACCAGAGTACATGGCCTTGCCCTTCAGATCTCT
GAGAACTTGTTTAGCAACAAAGTCCTCAATGCCTTGAAACCAGAAAAAGATGTGGATGGAGTAACAGAC
ATAAACCTGGGGAAGCTGGTGCGAGGGGATGCCCATGAATGTTTTGTTTCACCTGTTGCCAAAGCTGTA
ATTGAACTTCTTGAAAAATCAGGTGTCAACCTAGATGGAAAGAAGATTTTGGTAGTGGGGGCCCATGGG
TCTTTGGAAGCTGCTCTACAATGCCTGTTCCAGAGAAAAGGGTCCATGACAATGAGCATCCAGTGGAAA
ACACGCCAGCTTCAAAGCAAGACGGAGTCTCGTTCTGTCACCAGGCTGGAGTGCAGGCGCGTGATCTAG

Restriction Sites SgfI-RsrII     
ACCN NM_001242769
Insert Size 828 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242769.1
RefSeq Size 1072 bp
RefSeq ORF 828 bp
Locus ID 25902
UniProt ID Q6UB35
Protein Pathways Glyoxylate and dicarboxylate metabolism, Metabolic pathways, One carbon pool by folate
MW 29.8 kDa
Gene Summary The protein encoded by this gene is involved in the synthesis of tetrahydrofolate (THF) in the mitochondrion. THF is important in the de novo synthesis of purines and thymidylate and in the regeneration of methionine from homocysteine. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2011]
Transcript Variant: This variant (4) differs in the 3' UTR and coding sequence and uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (4) has a shorter and distinct C-terminus and lacks a single internal aa compared to isoform 1. Isoform 4 is thought to lack THF synthase activity.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...