ZKSCAN3 (NM_001242895) Human Untagged Clone

CAT#: SC331918

ZKSCAN3 (untagged) - Homo sapiens zinc finger with KRAB and SCAN domains 3 (ZKSCAN3), transcript variant 3



  "NM_001242895" in other vectors (2)

CNY 3,710.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to ZKSCAN3 (zinc finger with KRAB and SCAN domains 3)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ874C20.1; dJ874C20.1.; ZF47; zfp-47; Zfp47; ZFP306; ZNF306; ZNF309; ZSCAN13; ZSCAN35
Vector pCMV6-Entry
Sequence Data
>SC331918 representing NM_001242895.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCACTATTGACACCAGCCCCAGGGTCACAAAGTAGCCAATTTCAGCTAATGAAGGCTCTGCTCAAG
CATGAATCTGTGGGATCCCAGCCTTTACAAGATAGAGTTCTCCAGGTCCCCGTGCTTGCCCATGGAGGA
TGCTGCAGAGAAGATAAAGTGGTAGCTTCTAGGCTTACTCCAGAGTCCCAGGGGTTGTTGAAAGTGGAA
GATGTGGCCCTGACCCTCACCCCTGAATGGACACAGCAGGATTCATCTCAGGGGAATCTCTGTAGAGAT
GAAAAGCAGGAGAACCATGGCAGCCTGGTCTCCCTGGGTGATGAAAAACAGACTAAGAGCAGGGACTTG
CCTCCAGCTGAGGAGCTTCCAGAAAAGGAGCATGGGAAGATATCGTGCCACCTGAGAGAAGACATTGCC
CAGATTCCTACATGTGCAGAAGCTGGTGAACAGGAGGGCAGGCTACAAAGAAAGCAGAAAAATGCCACA
GGAGGGAGGCGGCACATCTGCCATGAATGTGGAAAGAGTTTTGCTCAAAGCTCAGGCCTGAGTAAACAC
AGGAGAATCCACACTGGTGAGAAACCCTACGAATGTGAAGAGTGTGGCAAAGCCTTCATTGGGAGCTCT
GCCCTTGTCATTCATCAGAGAGTCCACACTGGTGAGAAGCCATATGAGTGTGAAGAATGTGGTAAGGCC
TTCAGTCATAGCTCAGACCTTATCAAGCATCAGAGAACCCACACTGGGGAGAAGCCCTATGAGTGTGAT
GACTGTGGGAAGACCTTCAGCCAGAGCTGCAGCCTCCTTGAACATCACAGAATCCACACTGGGGAGAAG
CCGTATCAGTGCAGTATGTGTGGCAAAGCCTTTAGGCGAAGTTCACATCTCCTGAGACATCAGAGGATC
CATACTGGGGATAAAAATGTTCAGGAACCTGAGCAGGGAGAGGCCTGGAAAAGTAGGATGGAAAGCCAG
TTGGAAAATGTTGAAACTCCCATGTCTTATAAATGTAATGAGTGTGAAAGAAGTTTCACTCAGAATACA
GGCCTCATTGAACATCAAAAAATCCACACTGGTGAGAAACCCTATCAGTGTAATGCGTGTGGAAAAGGC
TTCACCCGAATTTCATACCTTGTTCAACATCAGAGAAGCCATGTAGGGAAAAACATCCTATCACAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242895
Insert Size 1173 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001242895.1
RefSeq Size 4261 bp
RefSeq ORF 1173 bp
Locus ID 80317
UniProt ID Q9BRR0
Protein Families Transcription Factors
MW 43.8 kDa
Gene Summary Transcriptional factor that binds to the consensus sequence 5'-[GT][AG][AGT]GGGG-3' and acts as a repressor of autophagy. Specifically represses expression of genes involved in autophagy and lysosome biogenesis/function such as MAP1LC3B, ULK1 or WIPI2. Associates with chromatin at the ITGB4 and VEGF promoters. Also acts as a transcription activator and promotes cancer cell progression and/or migration in various tumors and myelomas.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon compared to variant 1. The resulting protein (isoform 2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...