MAP3K8 (NM_001244134) Human Untagged Clone

CAT#: SC332065

MAP3K8 (untagged) - Homo sapiens mitogen-activated protein kinase kinase kinase 8 (MAP3K8), transcript variant 2



  "NM_001244134" in other vectors (2)

CNY 4,470.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
MAP3K8 mouse monoclonal antibody, clone OTI2E10 (formerly 2E10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AURA2; c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2
Vector pCMV6-Entry
Sequence Data
>SC332065 representing NM_001244134.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGTACATGAGCACTGGAAGTGACAATAAAGAAGAGATTGATTTATTAATTAAACATTTAAATGTG
TCTGATGTAATAGACATTATGGAAAATCTTTATGCAAGTGAAGAGCCAGCAGTTTATGAACCCAGTCTA
ATGACCATGTGTCAAGACAGTAATCAAAACGATGAGCGTTCTAAGTCTCTGCTGCTTAGTGGCCAAGAG
GTACCATGGTTGTCATCAGTCAGATATGGAACTGTGGAGGATTTGCTTGCTTTTGCAAACCATATATCC
AACACTGCAAAGCATTTTTATGGACAACGACCACAGGAATCTGGAATTTTATTAAACATGGTCATCACT
CCCCAAAATGGACGTTACCAAATAGATTCCGATGTTCTCCTGATCCCCTGGAAGCTGACTTACAGGAAT
ATTGGTTCTGATTTTATTCCTCGGGGCGCCTTTGGAAAGGTATACTTGGCACAAGATATAAAGACGAAG
AAAAGAATGGCGTGTAAACTGATCCCAGTAGATCAATTTAAGCCATCTGATGTGGAAATCCAGGCTTGC
TTCCGGCACGAGAACATCGCAGAGCTGTATGGCGCAGTCCTGTGGGGTGAAACTGTCCATCTCTTTATG
GAAGCAGGCGAGGGAGGGTCTGTTCTGGAGAAACTGGAGAGCTGTGGACCAATGAGAGAATTTGAAATT
ATTTGGGTGACAAAGCATGTTCTCAAGGGACTTGATTTTCTACACTCAAAGAAAGTGATCCATCATGAT
ATTAAACCTAGCAACATTGTTTTCATGTCCACAAAAGCTGTTTTGGTGGATTTTGGCCTAAGTGTTCAA
ATGACCGAAGATGTCTATTTTCCTAAGGACCTCCGAGGAACAGAGATTTACATGAGCCCAGAGGTCATC
CTGTGCAGGGGCCATTCAACCAAAGCAGACATCTACAGCCTGGGGGCCACGCTCATCCACATGCAGACG
GGCACCCCACCCTGGGTGAAGCGCTACCCTCGCTCAGCCTATCCCTCCTACCTGTACATAATCCACAAG
CAAGCACCTCCACTGGAAGACATTGCAGATGACTGCAGTCCAGGGATGAGAGAGCTGATAGAAGCTTCC
CTGGAGAGAAACCCCAATCACCGCCCAAGAGCCGCAGACCTACTAAAACATGAGGCCCTGAACCCGCCC
AGAGAGGATCAGCCACGCTGTCAGAGTCTGGACTCTGCCCTCTTGGAGCGCAAGAGGCTGCTGAGTAGG
AAGGAGCTGGAACTTCCTGAGAACATTGCTGATTCTTCGTGCACAGGAAGCACCGAGGAATCTGAGATG
CTCAAGAGGCAACGCTCTCTCTACATCGACCTCGGCGCTCTGGCTGGCTACTTCAATCTTGTTCGGGGA
CCACCAACGCTTGAATATGGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001244134
Insert Size 1404 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001244134.1
RefSeq Size 2782 bp
RefSeq ORF 1404 bp
Locus ID 1326
UniProt ID P41279
Protein Families Druggable Genome, Protein Kinase
Protein Pathways MAPK signaling pathway, T cell receptor signaling pathway, Toll-like receptor signaling pathway
MW 52.9 kDa
Gene Summary This gene is an oncogene that encodes a member of the serine/threonine protein kinase family. The encoded protein localizes to the cytoplasm and can activate both the MAP kinase and JNK kinase pathways. This protein was shown to activate IkappaB kinases, and thus induce the nuclear production of NF-kappaB. This protein was also found to promote the production of TNF-alpha and IL-2 during T lymphocyte activation. This gene may also utilize a downstream in-frame translation start codon, and thus produce an isoform containing a shorter N-terminus. The shorter isoform has been shown to display weaker transforming activity. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Variants 1-3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...