CLEC4G (NM_001244856) Human Untagged Clone

CAT#: SC332099

CLEC4G (untagged) - Homo sapiens C-type lectin domain family 4, member G (CLEC4G), transcript variant 2



  "NM_001244856" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CLEC4G Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DTTR431; LP2698; LSECtin; UNQ431
Vector pCMV6-Entry
Sequence Data
>SC332099 representing NM_001244856.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACACCACCAGGTACAGGCCCTGGGGACGCTGGGTGCACTGGAGCAGGAGACCCCTCTTCTTGGCC
CTGGCTGTCCTGGTCACCACAGTCCTTTGGGCTGTGATTCTGAGTATCCTATTGTCCAAGGCCTCCACG
GAGCGCGCGGCGCTGCTTGACGGCCACGACCTGCTGAGGACAAACGCCTCGAAGCAGACGGCGGCGCTG
GGTGCCCTGAAGGAGGAGGTCGGAGACTGCCACAGCTGCTGCTCGGGGACGCAGGCGCAGCTGCAGACC
ACGCGCGCGGAGCTTGGGGAGGCGCAGGCGAAGCTGATGGAGCAGGAGAGCGCCCTGCGGGAACTGCGT
GAGCGCGTGACCCAGGGCTTGGCTGAAGCCGGCAGGGGCCGTGAGGACGTCCGCACTGAGCTGTTCCGG
GCGCTGGAGGCCGTGAGGCTCCAGAACAACTCCTGCGAGCCGTGCCCCACGTCGTGGCTGTCCTTCGAG
GGCTCCTGCTACTTTTTCTCTGTGCCAAAGACGACGTGGGCGGCGGCGCAGGATCACTGCGCAGATGCC
AGCGCGCACCTGGTGATCGTTGGGGGCCTGGATGAGCAGGGCTTCCTCACTCGGAACACGCGTGGCCGT
GGTTACTGGCTGGGCCTGAGGGCTGTGCGCCATCTGGGCAAGGTTCAGGGCTACCAGTGGGTGGACGGA
GTCTCTCTCAGCTTCAGCCACTGGAACCAGGGAGAGCCCAATGACGCTTGGGGGCGCGAGAACTGTGTC
ATGATGCTGCACACGGGGCTGTGGAACGACGCACCGTGTGACAGCGAGAAGGACGGCTGGATCTGTGAG
AAAAGGCACAACTGCTGA

Restriction Sites SgfI-RsrII     
ACCN NM_001244856
Insert Size 846 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001244856.1
RefSeq Size 1341 bp
RefSeq ORF 846 bp
Locus ID 339390
Protein Families Druggable Genome, Transmembrane
MW 31.5 kDa
Gene Summary This gene encodes a glycan-binding receptor and member of the C-type lectin family which plays a role in the immune response. C-type lectin receptors are pattern recognition receptors located on immune cells that play a role in the recognition and uptake of both self and non-self glycoproteins as well as mediating cell adhesion, glycoprotein clearance, and cell signaling functions. This gene's protein binds complex-type N-glycans of the viral envelope proteins of Ebola virus, West Nile filovirus, and SARS coronavirus, but not HIV or hepatitis C virus. In mouse, this protein has been shown to recognize activated T-cells and to negatively regulate T-cell receptor-mediated signalling. It also acts as a novel, liver-specific regulator of NK cell-mediated immunity in mouse. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2020]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...