TBPL1 (NM_001253676) Human Untagged Clone

CAT#: SC332215

TBPL1 (untagged) - Homo sapiens TBP-like 1 (TBPL1), transcript variant 1



  "NM_001253676" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


TBPL1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MGC:8389; MGC:9620; STUD; TLF; TLP; TRF2
Vector pCMV6-Entry
Sequence Data
>SC332215 representing NM_001253676.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGATGCAGACAGTGATGTTGCATTGGACATTCTAATTACAAATGTAGTCTGTGTTTTTAGAACAAGA
TGTCATTTAAACTTAAGGAAGATTGCTTTGGAAGGAGCAAATGTAATTTATAAACGTGATGTTGGAAAA
GTATTAATGAAGCTTAGAAAACCTAGAATTACAGCTACAATTTGGTCCTCAGGAAAAATTATTTGCACT
GGAGCAACAAGTGAAGAAGAAGCTAAATTTGGTGCCAGACGCTTAGCCCGTAGTCTGCAGAAACTAGGT
TTTCAGGTAATATTTACAGATTTTAAGGTTGTTAACGTTCTGGCAGTGTGTAACATGCCATTTGAAATC
CGTTTGCCAGAATTCACAAAGAACAATAGACCTCATGCCAGTTACGAACCTGAACTTCATCCTGCTGTG
TGCTATCGGATAAAATCTCTAAGAGCTACATTACAGATTTTTTCAACAGGAAGTATCACAGTAACAGGG
CCCAATGTAAAGGCTGTTGCTACTGCTGTGGAACAGATTTACCCATTTGTGTTTGAAAGCAGGAAAGAA
ATTTTATAA

Restriction Sites SgfI-MluI     
ACCN NM_001253676
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001253676.1
RefSeq Size 1635 bp
RefSeq ORF 561 bp
Locus ID 9519
UniProt ID P62380
Protein Families Transcription Factors
Protein Pathways Basal transcription factors, Huntington's disease
MW 20.9 kDa
Gene Summary This gene encodes a member of the TATA box-binding protein family. TATA box-binding proteins play a critical role in transcription by RNA polymerase II as components of the transcription factor IID (TFIID) complex. The encoded protein does not bind to the TATA box and initiates transcription from TATA-less promoters. This gene plays a critical role in spermatogenesis, and single nucleotide polymorphisms in this gene may be associated with male infertility. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...