C6orf134 (ATAT1) (NM_001254952) Human Untagged Clone

CAT#: SC332273

ATAT1 (untagged) - Homo sapiens alpha tubulin acetyltransferase 1 (ATAT1), transcript variant 5



  "NM_001254952" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal anti-C6orf134 antibody
    • 100 ug

CNY 4,381.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms alpha-TAT; alpha-TAT1; C6orf134; MEC17; Nbla00487; TAT
Vector pCMV6-Entry
Sequence Data
>SC332273 representing NM_001254952.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGTTCCCGTTCGATGTGGACGCGCTGTTCCCGGAGCGGATCACGGTGCTGGACCAGCACCTGAGG
CCCCCAGCCCGCCGACCCGGAACCACAACGCCGGCCCGTGTTGATCTACAGCAGCAAATTATGACCATT
ATAGATGAACTGGGCAAGGCTTCTGCCAAGGCCCAGAATCTTTCCGCTCCTATCACTAGTGCATCAAGG
ATGCAGAGTAACCGCCATGTTGTTTATATTCTCAAAGACAGTTCAGCCCGACCGGCTGGAAAAGGAGCC
ATTATTGGTTTCATCAAAGTTGGATACAAGAAGCTCTTTGTACTGGATGATCGTGAGGCTCATAATGAG
GTAGAACCACTTTGCATCCTGGACTTTTACATCCATGAGTCTGTGCAACGCCATGGCCATGGGCGAGAA
CTCTTCCAGTATATGTTGCAGAAGGAGCGAGTGGAACCGCACCAACTGGCAATTGACCGACCCTCACAG
AAGCTGCTGAAATTCCTGAATAAGCACTACAATCTGGAGACCACAGTCCCACAGGTGAACAACTTTGTG
ATCTTTGAAGGCTTCTTTGCCCATCAACATCCTCCAGCAAGGAAGCTGCCACCCAAGAGAGCAGAGGGA
GACATCAAGCCATACTCCTCTAGTGACCGAGAATTTCTGAAGGTAGCTGTGGAGCCTCCTTGGCCCCTA
AACAGGGCCCCTCGCCGCGCCACACCTCCAGCCCACCCACCCCCCCGCTCCAGCAGCCTGGGAAACTCA
CCAGAACGAGGTCCCCTCCGCCCCTTTGTGCCAGAGCAGGAGCTGCTGCGTTCCTTGCGCCTCTGCCCC
CCACACCCTACCGCCCGCCTTCTGTTGGCTGCTGACCCTGGGGGCAGCCCAGCTCAACGTCGTCGCACC
AGCTCCCTTCCCCGCTCTGAGGAGAGTCGATACTAA

Restriction Sites SgfI-MluI     
ACCN NM_001254952
Insert Size 933 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001254952.1
RefSeq Size 2098 bp
RefSeq ORF 933 bp
Locus ID 79969
UniProt ID Q5SQI0
MW 35.1 kDa
Gene Summary This gene encodes a protein that localizes to clathrin-coated pits, where it acetylates alpha tubulin on lysine 40. This process may be important in microtubule growth, for instance during chemotaxis and the formation of cilium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (5) differs in the 5' and 3' UTRs and coding region, and lacks an internal in-frame exon, compared to variant 1. The encoded isoform (4) has distinct N- and C-termini and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...