Glycophorin C (GYPC) (NM_001256584) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	CD236; CD236R; GE; GE:GPC:GPD:GYPD; GPC; GPD; GYPD; PAS-2; PAS-2'
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC332423 representing NM_001256584. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTGCAGAGCCTGATCCAGGGATGTCTGGATGG CCGGATGGCAGAATGGAGACCTCCACCCCCACCATAATGGACATTGTCGTCATTGCAGGTGTGATTGCT GCTGTGGCCATCGTCCTAGTCTCCCTCCTCTTCGTCATGCTGCGCTACATGTACCGGCACAAGGGCACG TACCACACCAATGAGGCCAAGGGCACGGAGTTTGCTGAGAGTGCAGATGCAGCCCTGCAGGGAGACCCT GCCCTCCAAGATGCTGGTGATAGCAGCAGAAAGGAGTACTTTATTTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001256584
Insert Size	324 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001256584.1
RefSeq Size	2067 bp
RefSeq ORF	324 bp
Locus ID	2995
UniProt ID	P04921
Protein Families	Druggable Genome, Transmembrane
MW	11.5 kDa
Gene Summary	Glycophorin C (GYPC) is an integral membrane glycoprotein. It is a minor species carried by human erythrocytes, but plays an important role in regulating the mechanical stability of red cells. A number of glycophorin C mutations have been described. The Gerbich and Yus phenotypes are due to deletion of exon 3 and 2, respectively. The Webb and Duch antigens, also known as glycophorin D, result from single point mutations of the glycophorin C gene. The glycophorin C protein has very little homology with glycophorins A and B. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (3) has an additional exon, compared to variant 1. This variant represents translation initiation at a downstream AUG compared to variant 1; the 5'-most initiation codon, as used in variant 1, is associated with a weak Kozak sequence and a truncated ORF that would render the transcript a candidate for nonsense-mediated decay (NMD). Leaky scanning may allow translation initiation at the downstream AUG, which is associated with a strong Kozak sequence. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.