PPP1R1C (NM_001261424) Human Untagged Clone
CAT#: SC332773
PPP1R1C (untagged) - Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C), transcript variant 1
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IPP5 |
Vector | pCMV6-Entry |
Sequence Data |
>SC332773 representing NM_001261424.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAGCCCAACAGTCCCAAAAAGATACAGTTTGCCGTGCCTGTATTCCAGAGTCAGATTGCACCTGAA GCAGCAGAGCAGCTGGGCTTTTGTCGTTCACAGATCAGGAAAAGAAGACCTACACCAGCATCACTTGTG ATTCTCAATGAGCATAACCCCCCAGAAATAGATGACAAGAGGGGGCCCAACACACAAGGGGAATTACAG AATGCATCCCCTAAGCAAAGGAAGCAGAGTGTGTACACACCACCCACCATAAAAGGGGTTAAGCATCTG AAAGGCCAGAATGAATCAGCATTCCCTGAAGAAGAAGAAGGCACCAATGAAAGAGAGGAGCAGCGGGAC CATTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001261424 |
Insert Size | 351 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001261424.1 |
RefSeq Size | 3053 bp |
RefSeq ORF | 351 bp |
Locus ID | 151242 |
UniProt ID | Q8WVI7 |
Protein Families | Druggable Genome, Phosphatase |
MW | 13.1 kDa |
Gene Summary | Protein phosphatase-1 (PP1) is a major serine/threonine phosphatase that regulates a variety of cellular functions. PP1 consists of a catalytic subunit (see PPP1CA; MIM 176875) and regulatory subunits that determine the subcellular localization of PP1 or regulate its function. PPP1R1C belongs to a group of PP1 inhibitory subunits that are themselves regulated by phosphorylation (Wang et al., 2008 [PubMed 18310074]).[supplied by OMIM, Feb 2010] Transcript Variant: This variant (1) encodes the longest protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233276 | PPP1R1C (Myc-DDK tagged) - Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C), transcript variant 1 |
CNY 3,990.00 |
|
RG233276 | PPP1R1C (tGFP-tagged) - Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C), transcript variant 1 |
CNY 4,370.00 |
其它PPP1R1C产品