RTN3 (NM_001265591) Human Untagged Clone

CAT#: SC332812

RTN3 (untagged) - Homo sapiens reticulon 3 (RTN3), transcript variant 7



  "NM_001265591" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
RTN3 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ASYIP; HAP; NSPL2; NSPLII; RTN3-A1
Vector pCMV6-Entry
Sequence Data
>SC332812 representing NM_001265591.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGAGCCGTCGGCGGCCACTCAGTCCCATTCCATCTCCTCGTCGTCCTTCGGAGCCGAGCCGTCC
GCGCCCGGCGGCGGCGGGAGCCCAGGAGCCTGCCCCGCCCTGGGGACGAAGAGCTGCAGCTCCTCCTGT
GCGGTGCACGATCTGATTTTCTGGAGAGATGTGAAGAAGACTGGGTTTGTCTTTGGCACCACGCTGATC
ATGCTGCTTTCCCTGGCAGCTTTCAGTGTCATCAGTGTGGTTTCTTACCTCATCCTGGCTCTTCTCTCT
GTCACCATCAGCTTCAGGATCTACAAGTCCGTCATCCAAGCTGTACAGAAGTCAGAAGAAGGCCATCCA
TTCAAACCCAGATTGATCACTATGTTGGCATCGCCCGAGATCAGACCAAGTCAATTGTTGAAAAGATCC
AAGCAAAACTCCCTGGAATCGCCAAAAAAAAGGCAGAATAAGTACATGGAAACCAGAAATGCAACAGTT
ACTAAAACACCATTTAATAGTTATAACGTCGTTACTTGTACTATGAAGGAAAATACTCAGTGTCAGCTT
GAGCCTGCATTCCAAGCTTTTTTTTTAATTTGGTGTTTTCTCCCATCCTTTCCCTTTAACCCTCAGTAT
CAAGCACAAAAATTGATGGACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001265591
Insert Size 645 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001265591.1
RefSeq Size 2332 bp
RefSeq ORF 645 bp
Locus ID 10313
UniProt ID O95197
Protein Families Transmembrane
MW 23.5 kDa
Gene Summary This gene belongs to the reticulon family of highly conserved genes that are preferentially expressed in neuroendocrine tissues. This family of proteins interact with, and modulate the activity of beta-amyloid converting enzyme 1 (BACE1), and the production of amyloid-beta. An increase in the expression of any reticulon protein substantially reduces the production of amyloid-beta, suggesting that reticulon proteins are negative modulators of BACE1 in cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, and pseudogenes of this gene are located on chromosomes 4 and 12. [provided by RefSeq, May 2012]
Transcript Variant: This variant (7) lacks three consecutive exons in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (g) is shorter and has a distinct C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...