RPP38 (NM_001265601) Human Untagged Clone

CAT#: SC332820

RPP38 (untagged) - Homo sapiens ribonuclease P/MRP 38kDa subunit (RPP38), transcript variant 4



  "NM_001265601" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
RPP38 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC332820 representing NM_001265601.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTGCAGCTCCTCAAGCACCGGGGCGGGGATCTCTCCGTAAGACGAGACCTCTGGTTGTGAAGACG
TCGTTGAACAACCCATACATCATCCGCTGGAGCGCTCTGGAGAGCGAGGATATGCACTTCATCCTACAG
ACGCTTGAGGACAGGCTTAAAGCTATTGGACTTCAGAAGATTGAAGATAAGAAGAAAAAGAACAAAACA
CCTTTTCTGAAAAAAGAAAGCAGAGAGAAATGCAGCATTGCTGTTGATATTAGTGAGAATCTGAAGGAG
AAGAAAACAGATGCTAAGCAGCAAGTGTCAGGGTGGACGCCTGCACACGTCAGGAAGCAGCTTGCCATT
GGCGTTAACGAAGTTACCAGAGCCCTGGAAAGGAGGGAACTGCTGTTAGTTCTGGTGTGTAAATCAGTC
AAGCCTGCCATGATCACCTCACACTTGATTCAGTTAAGCCTAAGCAGAAGTGTCCCTGCCTGTCAGGTC
CCCCGGCTCAGTGAGAGAATCGCCCCCGTCATTGGCTTAAAATGTGTTCTAGCCTTGGCGTTCAAAAAG
AACACCACTGACTTTGTGGACGAAGTAAGAGCCATCATCCCCAGAGTCCCCAGTTTAAGTGTACCATGG
CTTCAAGACAGAATTGAAGATTCTGGGGAAAATTTAGAGACTGAACCTCTGGAAAGCCAAGACAGAGAG
CTTTTGGACACTTCATTTGAAGATCTGTCAAAACCTAAGAGAAAGCTTGCTGACGGTCGGCAGGCTTCT
GTAACATTACAACCCCTTAAAATAAAGAAACTGATTCCAAACCCTAATAAGATAAGGAAACCACCCAAA
AGTAAAAAAGCTACTCCAAAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001265601
Insert Size 852 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001265601.1
RefSeq Size 1554 bp
RefSeq ORF 852 bp
Locus ID 10557
UniProt ID P78345
Protein Families Druggable Genome
MW 31.8 kDa
Gene Summary Component of ribonuclease P, a ribonucleoprotein complex that generates mature tRNA molecules by cleaving their 5'-ends (PubMed:9037013, PubMed:9630247, PubMed:10444065, PubMed:30454648). Also a component of the MRP ribonuclease complex, which cleaves pre-rRNA sequences (PubMed:28115465).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. All variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...