ING1 (NM_001267728) Human Untagged Clone

CAT#: SC332877

ING1 (untagged) - Homo sapiens inhibitor of growth family, member 1 (ING1), transcript variant 5



  "NM_001267728" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal ING1 Antibody
    • 100 ug

CNY 5,302.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms p24ING1c; p33; p33ING1; p33ING1b; p47; p47ING1a
Vector pCMV6-Entry
Sequence Data
>SC332877 representing NM_001267728.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCTTCGTGGAATGTCCTTATCATTCCCCTGCGGAACGATTGGTCGCTGAGGCGGATGAAGGCGGG
CCTAGCGCAATAACTGAGATCCTGAAGGAGCTAGACGAGTGCTACGAGCGCTTCAGTCGCGAGACAGAC
GGGGCGCAGAAGCGGCGGATGCTGCACTGTGTGCAGCGCGCGCTGATCCGCAGCCAGGAGCTGGGCGAC
GAGAAGATCCAGATCGTGAGCCAGATGGTGGAGCTGGTGGAGAACCGCACGCGGCAGGTGGACAGCCAC
GTGGAGCTGTTCGAGGCGCAGCAGGAGCTGGGCGACACAGCGGGCAACAGCGGCAAGGCTGGCGCGGAC
AGGCCCAAAGGCGAGGCGGCAGCGCAGGCTGACAAGCCCAACAGCAAGCGCTCACGGCGGCAGCGCAAC
AACGAGAACCGTGAGAACGCGTCCAGCAACCACGACCACGACGACGGCGCCTCGGGCACACCCAAGGAG
AAGAAGGCCAAGACCTCCAAGAAGAAGAAGCGCTCCAAGGCCAAGGCGGAGCGAGAGGCGTCCCCTGCC
GACCTCCCCATCGACCCCAACGAACCCACGTACTGTCTGTGCAACCAGGTCTCCTATGGGGAGATGATC
GGCTGCGACAACGACGAGTGCCCCATCGAGTGGTTCCACTTCTCGTGCGTGGGGCTCAATCATAAACCC
AAGGGCAAGTGGTACTGTCCCAAGTGCCGGGGGGAGAACGAGAAGACCATGGACAAAGCCCTGGAGAAA
TCCAAAAAAGAGAGGGCTTACAACAGGTAG

Restriction Sites SgfI-RsrII     
ACCN NM_001267728
Insert Size 789 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001267728.1
RefSeq Size 1956 bp
RefSeq ORF 789 bp
Locus ID 3621
UniProt ID Q9UK53
Protein Families Druggable Genome, Transcription Factors
MW 29.6 kDa
Gene Summary This gene encodes a tumor suppressor protein that can induce cell growth arrest and apoptosis. The encoded protein is a nuclear protein that physically interacts with the tumor suppressor protein TP53 and is a component of the p53 signaling pathway. Reduced expression and rearrangement of this gene have been detected in various cancers. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (5) lacks an internal segment in the 5' coding region, compared to variant 4. The resulting isoform (E) lacks an internal segment, as compared to isoform D.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...