DEDD2 (NM_001270615) Human Untagged Clone

CAT#: SC332985

DEDD2 (untagged) - Homo sapiens death effector domain containing 2 (DEDD2), transcript variant 3



  "NM_001270615" in other vectors (2)

CNY 3,140.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DEDD2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FLAME-3; FLAME3
Vector pCMV6-Entry
Sequence Data
>SC332985 representing NM_001270615.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGCTATCCGGGTCGACCCCGGCCCCGTGCTGGGAGGAGGATGAGTGCCTGGACTACTACGGGATG
CTGTCGCTTCACCGTATGTTCGAGGTGGTGGGCGGGCAACTGACCGAGTGCGAGCTGGAGCTCCTGGCC
TTTCTGCTGGATGAGGCTCCTGGCGCCGCCGGAGGCTTAGCCCGGGCCCGCAGCGGCCTAGAGCTCCTG
CTGGAGCTGGAGCGCCGCGGGCAGTGCGACGAGAGCAACCTGCGGCTGCTGGGGCAACTCCTGCGCGTG
CTGGCCCGCCACGACCTGCTGCCGCACCTGGCGCGCAAGCGGCGCCGGCCAGTGTCTCCAGAACGCTAT
AGCTATGGCACCTCCAGCTCTTCAAAGAGGACAGAGGGTAGCTGCCGTCGCCGTCGGCAGTCAAGCAGT
TCTGCAAATTCTCAGCAGGGCTCCCCCCCAACCAAGCGGCAGCGGCGGAGTCGGGGCCGGCCCAGTGGT
GGTGCCAGACGGCGGCGGAGAGGGGCCCCAGCCGCACCCCAGCAGCAGTCAGAGCCCGCCAGACCTTCC
TCTGAAGGCAAAGTGACCTGTGACATCCGGCTCCGGGTTCGAGCAGAGTACTGCGAGCATGGGCCAGCC
TTGGAGCAGGGCGTGGCATCCCGGCGGCCCCAGGCGCTGGCGCGGCAGCTGGACGTGTTTGGGCAGGCC
ACCGCAGTGCTGCGCTCAAGGGACCTGGGCTCTGTGGTTTGTGACATCAAGTTCTCAGAGCTCTCCTAT
CTGGACGCCTTCTGGGGCGACTACCTGAGTGGCGCCCTGCTGCAGGCCCTGCGGGGCGTGTTCCTGACT
GAGGCCCTGCGAGAGGCTGTGGGCCGGGAGGCTGTTCGCCTGCTGGTCAGTGTGGATGAGGCTGACTAT
GAGGCTGGCCGGCGCCGCCTGTTGCTGATGGAGGAGGAAGGGGGGCGGCGCCCGACAGAGGCCTCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270615
Insert Size 966 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270615.1
RefSeq Size 2010 bp
RefSeq ORF 966 bp
Locus ID 162989
UniProt ID Q8WXF8
Protein Families Druggable Genome, Transcription Factors
MW 35.6 kDa
Gene Summary This gene encodes a nuclear-localized protein containing a death effector domain (DED). The encoded protein may regulate the trafficking of caspases and other proteins into the nucleus during death receptor-induced apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (3) uses an alternate in-frame splice site in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...