GABRG3 (NM_001270873) Human Untagged Clone

CAT#: SC333005

GABRG3 (untagged) - Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 3 (GABRG3), transcript variant 2



  "NM_001270873" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
GABRG3 Antibody - N-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC333005 representing NM_001270873.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCCCGAAGCTGCTGCTCCTCCTCTGCCTGTTCTCGGGCTTGCACGCGCGGTCCAGAAAGGTGGAA
GAGGATGAATATGAAGATTCATCATCAAACCAAAAGTGGGTCTTGGCTCCAAAATCCCAAGACACCGAC
GTGACTCTTATTCTCAACAAGTTGCTAAGAGAATATGATAAAAAGCTGAGGCCAGATATTGGAATAAAA
CCGACCGTAATTGACGTTGACATTTATGTTAACAGCATTGGTCCTGTGTCATCAATAAACATGGAATAC
CAAATTGACATATTTTTTGCTCAGACCTGGACAGATAGTCGCCTTCGATTCAACAGCACAATGAAAATT
CTTACTCTGAACAGCAACATGGTGGGGTTAATCTGGATCCCAGACACCATCTTCCGCAATTCTAAAACC
GCAGAGGCTCACTGGATCACCACACCCAATCAGCTCCTCCGGATTTGGAATGACGGGAAAATCCTTTAC
ACTTTGAGGCTCACCATCAATGCTGAGTGCCAGCTGCAGCTGCACAACTTCCCCATGGACGAACACTCC
TGCCCGCTGATTTTCTCCAGCTATGGCTATCCCAAAGAAGAAATGATTTATAGATGGAGAAAAAATTCA
GTGGAGGCAGCTGACCAGAAATCATGGCGGCTTTATCAGTTTGACTTCATGGGCCTCAGAAACACCACA
GAAATCGTGACAACGTCTGCAGGTAGGAATTTACTGAAAGAGGCACAGCTCTCAAAAGCCAGAGAGGCC
TAA

Restriction Sites SgfI-MluI     
ACCN NM_001270873
Insert Size 762 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270873.1
RefSeq Size 1512 bp
RefSeq ORF 762 bp
Locus ID 2567
UniProt ID Q99928
Protein Families Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
MW 29.4 kDa
Gene Summary This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. The protein encoded by this gene is a gamma subunit, which contains the benzodiazepine binding site. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (2) lacks several exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform 2 which is longer/shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...