IST1 (NM_001270975) Human Untagged Clone

CAT#: SC333017

IST1 (untagged) - Homo sapiens increased sodium tolerance 1 homolog (yeast) (IST1), transcript variant 1



  "NM_001270975" in other vectors (2)

CNY 3,520.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


IST1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CHMP8; OLC1
Vector pCMV6-Entry
Sequence Data
>SC333017 representing NM_001270975.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTGGGCTCTGGATTTAAAGCTGAGCGCTTAAGAGTGAATTTGAGATTAGTCATAAATCGCCTTAAA
CTATTGGAGAAAAAGAAAACGGAACTGGCCCAGAAAGCAAGGAAGGAGATTGCTGACTATCTGGCTGCT
GGGAAAGATGAACGAGCTCGGATCCGTGTGGAGCACATTATCCGGGAAGACTACCTCGTGGAGGCCATG
GAGATCCTGGAGCTGTACTGTGACCTGCTGCTGGCTCGGTTTGGCCTTATCCAGTCTATGAAGGAACTA
GATTCTGGTCTGGCTGAATCTGTGTCTACATTGATCTGGGCTGCTCCTCGACTCCAGTCAGAAGTGGCT
GAGTTGAAAATAGTTGCTGATCAGCTCTGTGCCAAGTATAGCAAGGAATATGGCAAGCTATGTAGGACC
AACCAGATTGGAACTGTGAATGACAGGCTAATGCACAAGCTGAGTGTGGAAGCCCCACCCAAAATCCTG
GTGGAGAGATACCTGATTGAAATTGCAAAGAATTACAACGTACCCTATGAACCTGACTCTGTGGTCATG
GCAGAAGCTCCTCCTGGGGTAGAGACAGATCTTATTGATGTTGGATTCACAGATGATGTGAAGAAAGGA
GGCCCTGGAAGAGGAGGGAGTGGTGGCTTCACAGCACCAGTTGGTGGACCTGATGGAACGGTGCCAATG
CCCATGCCCATGCCCATGCCTATGCCATCTGCAAATACGCCTTTCTCATATCCACTGCCAAAGGGACCA
TCAGATTTCAATGGACTGCCAATGGGGACTTATCAGGCCTTTCCCAATATTCATCCACCTCAGATACCA
GCAACTCCCCCATCGTATGAATCTGTAGATGACATTAATGCTGATAAGAATATCTCTTCTGCACAGATT
GTTGGTCCTGGACCCAAGCCAGAAGCCTCTGCAAAGCTTCCTTCCAGACCTGCAGATAACTATGACAAC
TTTGTCCTACCAGAGTTGCCATCTGTGCCAGACACACTACCAACTGCATCTGCTGGTGCCAGCACCTCA
GCATCTGAAGACATTGACTTTGATGATCTTTCCCGGAGGTTTGAAGAGCTGAAAAAGAAAACATAG

Restriction Sites SgfI-MluI     
ACCN NM_001270975
Insert Size 1101 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270975.1
RefSeq Size 4039 bp
RefSeq ORF 1101 bp
Locus ID 9798
UniProt ID P53990
MW 40 kDa
Gene Summary This gene encodes a protein with MIT-interacting motifs that interacts with components of endosomal sorting complexes required for transport (ESCRT). ESCRT functions in vesicle budding, such as that which occurs during membrane abscission in cytokinesis. There is a pseudogene for this gene on chromosome 19. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (1) encodes isoform a (also known as hIST1c). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...