Prion protein PrP (PRNP) (NM_001271561) Human Untagged Clone
CAT#: SC333064
PRNP (untagged) - Homo sapiens prion protein (PRNP), transcript variant 6
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AltPrP; ASCR; CD230; CJD; GSS; KURU; p27-30; PRIP; PrP; PrP27-30; PrP33-35C; PrPc |
Vector | pCMV6-Entry |
Sequence Data |
>SC333064 representing NM_001271561.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGAACACTGGGGGCAGCCGATACCCGGGGCAGGGCAGCCCTGGAGGCAACCGCTACCCACCTCAGGG CGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC CCATGGTGGTGGCTGGGGACAGCCTCATGGTGGTGGCTGGGGTCAAGGAGGTGGCACCCACAGTCAGTG GAACAAGCCGAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271561 |
Insert Size | 222 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001271561.1 |
RefSeq Size | 2740 bp |
RefSeq ORF | 222 bp |
Locus ID | 5621 |
UniProt ID | P04156 |
Protein Families | ES Cell Differentiation/IPS, Stem cell - Pluripotency, Transmembrane |
Protein Pathways | Prion diseases |
MW | 8.7 kDa |
Gene Summary | The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (2) encodes multiple distinct proteins due to the use of alternate translation initiation codons. The longer protein (Prp, PMID:21478263) represents the canonical protein, while a shorter protein (AltPrp, PMID:21478263) that uses a different, but overlapping reading frame has also been described. Alternative prion protein (AltPrp) has no sequence similarity to Prp and localizes to the outer mitochondrial membrane. This RefSeq represents the shorter protein, AltPrp. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Prion protein PrP产品
Customer
Reviews
Loading...