GLUT8 (SLC2A8) (NM_001271712) Human Untagged Clone

CAT#: SC333091

SLC2A8 (untagged) - Homo sapiens solute carrier family 2 (facilitated glucose transporter), member 8 (SLC2A8), transcript variant 3



  "NM_001271712" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SLC2A8 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GLUT8; GLUTX1
Vector pCMV6-Entry
Sequence Data
>SC333091 representing NM_001271712.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTCGTCGTCGGCATCCTCCTGGCCTACCTGGCAGGCTGGGTGCTGGAGTGGCGCTGGCTGGCTGTG
CTGGGCTGCGTGCCCCCCTCCCTCATGCTGCTTCTCATGTGCTTCATGCCCGAGACCCCGCGCTTCCTG
CTGACTCAGCACAGGCGCCAGGAGGCCATGGCCGCCCTGCGGTTCCTGTGGGGCTCCGAGCAGGGCTGG
GAAGACCCCCCCATCGGGGCTGAGCAGAGCTTTCACCTGGCCCTGCTGCGGCAGCCCGGCATCTACAAG
CCCTTCATCATCGGCGTCTCCCTGATGGCCTTCCAGCAGCTGTCGGGGGTCAACGCCGTCATGTTCTAT
GCAGAGACCATCTTTGAAGAGGCCAAGTTCAAGGACAGCAGCCTGGCCTCGGTCGTCGTGGGTGTCATC
CAGGTGCTGTTCACAGCTGTGGCGGCTCTCATCATGGACAGAGCAGGGCGGAGGCTGCTCCTGGTCTTG
TCAGGTGTGGTCATGGTGTTCAGCACGAGTGCCTTCGGCGCCTACTTCAAGCTGACCCAGGGTGGCCCT
GGCAACTCCTCGCACGTGGCCATCTCGGCGCCTGTCTCTGCACAGCCTGTTGATGCCAGCGTGGGGCTG
GCCTGGCTGGCCGTGGGCAGCATGTGCCTCTTCATCGCCGGCTTTGCGGTGGGCTGGGGGCCCATCCCC
TGGCTCCTCATGTCAGAGATCTTCCCTCTGCATGTCAAGGGCGTGGCGACAGGCATCTGCGTCCTCACC
AACTGGCTCATGGCCTTTCTCGTGACCAAGGAGTTCAGCAGCCTCATGGAGGTCCTCAGGCCCTATGGA
GCCTTCTGGCTTGCCTCCGCTTTCTGCATCTTCAGTGTCCTTTTCACTTTGTTCTGTGTCCCTGAAACT
AAAGGAAAGACTCTGGAACAAATCACAGCCCATTTTGAGGGGCGATGA

Restriction Sites SgfI-MluI     
ACCN NM_001271712
Insert Size 945 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271712.1
RefSeq Size 1806 bp
RefSeq ORF 945 bp
Locus ID 29988
UniProt ID Q9NY64
Protein Families Transmembrane
MW 34.4 kDa
Gene Summary This gene belongs to the solute carrier 2A family, which includes intracellular glucose transporters. Based on sequence comparison, the glucose transporters are grouped into three classes and this gene is a member of class II. The encoded protein, like other members of the family, contains several conserved residues and motifs and 12 transmembrane domains with both amino and carboxyl ends being on the cytosolic side of the membrane. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (3) lacks two alternate exons in the 5' coding region and uses a downstream start codon compared to variant 1. It encodes isoform 3 which has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...