HOMER1 (NM_001277077) Human Untagged Clone

CAT#: SC333271

HOMER1 (untagged) - Homo sapiens homer homolog 1 (Drosophila) (HOMER1), transcript variant 2



  "NM_001277077" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
HOMER1 mouse monoclonal antibody,clone OTI7G10
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HOMER; HOMER1A; HOMER1B; HOMER1C; SYN47; Ves-1
Vector pCMV6-Entry
Sequence Data
>SC333271 representing NM_001277077.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGGAACAACCTATCTTCAGCACTCGAGCTCATGTCTTCCAAATTGACCCAAACACAAAGAAGAAC
TGGGTACCCACCAGCAAGCATGCAGTTACTGTGTCTTATTTCTATGACAGCACAAGAAATGTGTATAGG
ATAATCAGTTTAGATGGCTCAAAGGCAATAATAAATAGTACCATCACCCCAAACATGACATTTACTAAA
ACATCTCAGAAGTTTGGCCAGTGGGCTGATAGCCGGGCAAACACCGTTTATGGATTGGGATTCTCCTCT
GAGCATCATCTTTCGAAAGTGACTGAACTTGAATGTGTTAGTAGCCAAGCAAATGCAGTACATACTCAT
AAGACAGAATTAAATCAGACAATACAAGAACTGGAAGAGACACTGAAACTGAAGGAAGAGGAAATAGAA
AGGTTAAAACAAGAAATTGATAATGCCAGAGAACTACAAGAACAGAGGGATTCTTTGACTCAGAAACTA
CAGGAAGTAGAAATTCGGAACAAAGACCTGGAGGGACAACTGTCTGACTTAGAGCAACGTCTGGAGAAA
AGTCAGAATGAACAAGAAGCTTTTCGCAATAACCTGAAGACACTCTTAGAAATTCTGGATGGAAAGATA
TTTGAACTAACAGAATTACGAGATAACTTGGCCAAGCTACTAGAATGCAGCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001277077
Insert Size 675 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001277077.1
RefSeq Size 3922 bp
RefSeq ORF 675 bp
Locus ID 9456
UniProt ID Q86YM7
Protein Families Druggable Genome
MW 25.8 kDa
Gene Summary This gene encodes a member of the homer family of dendritic proteins. Members of this family regulate group 1 metabotrophic glutamate receptor function. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2, also known as HOMER1E) lacks three consecutive coding exons compared to variant 1. The missing segment is in-frame, so the resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...